Homologs in group_1217

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06635 FBDBKF_06635 94.7 Morganella morganii S1 ureH Urease accessory protein UreH
EHELCC_09680 EHELCC_09680 94.7 Morganella morganii S2 ureH Urease accessory protein UreH
NLDBIP_10060 NLDBIP_10060 94.7 Morganella morganii S4 ureH Urease accessory protein UreH
LHKJJB_07695 LHKJJB_07695 94.7 Morganella morganii S3 ureH Urease accessory protein UreH
HKOGLL_07245 HKOGLL_07245 94.7 Morganella morganii S5 ureH Urease accessory protein UreH
PMI_RS18320 PMI_RS18320 28.2 Proteus mirabilis HI4320 - urease accessory protein UreD

Distribution of the homologs in the orthogroup group_1217

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1217

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JR75 1.43e-176 494 71 0 321 3 ureD Urease accessory protein UreD Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P52316 1.43e-176 494 71 0 321 3 ureD Urease accessory protein UreD Yersinia pseudotuberculosis serotype I (strain IP32953)
B2KAA0 1.43e-176 494 71 0 321 3 ureD Urease accessory protein UreD Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FFN6 1.43e-176 494 71 0 321 3 ureD Urease accessory protein UreD Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JKE3 2.48e-175 491 69 1 327 3 ureD Urease accessory protein UreD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P42868 1.01e-166 469 70 1 310 3 ureD Urease accessory protein UreD Yersinia enterocolitica
Q7N4Y3 9.13e-147 418 64 0 306 3 ureD Urease accessory protein UreD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1CKJ5 3.26e-146 415 73 0 264 3 ureD Urease accessory protein UreD Yersinia pestis bv. Antiqua (strain Nepal516)
Q9ZFR5 3.26e-146 415 73 0 264 5 ureD Putative urease accessory protein UreD Yersinia pestis
Q1C5A9 3.26e-146 415 73 0 264 3 ureD Urease accessory protein UreD Yersinia pestis bv. Antiqua (strain Antiqua)
A4TL28 3.75e-145 412 72 0 264 3 ureD Urease accessory protein UreD Yersinia pestis (strain Pestoides F)
Q8FZV8 1.59e-113 333 50 1 302 3 ureD2 Urease accessory protein UreD 2 Brucella suis biovar 1 (strain 1330)
Q8YI02 1.59e-113 333 50 1 302 3 ureD2 Urease accessory protein UreD 2 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M618 1.17e-112 331 50 1 302 3 ureD2 Urease accessory protein UreD 2 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A5VRB2 1.06e-111 329 50 1 302 3 ureD2 Urease accessory protein UreD 2 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57CE4 7.48e-108 319 50 2 304 3 ureD2 Urease accessory protein UreD 2 Brucella abortus biovar 1 (strain 9-941)
Q2YQD5 7.48e-108 319 50 2 304 3 ureD2 Urease accessory protein UreD 2 Brucella abortus (strain 2308)
B1Z8R4 1.03e-98 296 47 1 301 3 ureD3 Urease accessory protein UreD 3 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A9W296 1.22e-94 286 45 1 301 3 ureD2 Urease accessory protein UreD 2 Methylorubrum extorquens (strain PA1)
Q75ZQ2 2.7e-42 151 33 4 275 3 ureD Urease accessory protein UreD Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A0RUR7 2.18e-41 148 31 3 277 3 ureD Urease accessory protein UreD Cenarchaeum symbiosum (strain A)
B1VSW8 8.83e-36 134 31 5 279 3 ureD2 Urease accessory protein UreD 2 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q3IRZ2 3.82e-34 129 30 7 276 3 ureD Urease accessory protein UreD Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q18EB6 6.97e-31 121 31 10 287 3 ureD Urease accessory protein UreD Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q07400 8.09e-22 95 27 8 280 3 ureD Urease accessory protein UreD Bacillus sp. (strain TB-90)
A5EDB3 1.36e-20 92 31 5 235 3 ureD1 Urease accessory protein UreD 1 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A4Z049 2.51e-20 92 27 5 285 3 ureD3 Urease accessory protein UreD 3 Bradyrhizobium sp. (strain ORS 278)
A4T7D6 5.31e-20 91 24 3 253 3 ureD Urease accessory protein UreD Mycolicibacterium gilvum (strain PYR-GCK)
Q55058 2.38e-19 89 24 8 277 3 ureD Urease accessory protein UreD Streptococcus salivarius (strain 57.I)
Q117Z6 3.38e-19 89 29 4 234 3 ureD Urease accessory protein UreD Trichodesmium erythraeum (strain IMS101)
B6JPH0 1.63e-18 87 30 3 161 3 ureH Urease accessory protein UreH Helicobacter pylori (strain P12)
Q03MD9 3.88e-18 85 24 9 277 3 ureD Urease accessory protein UreD Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B2UW64 4.13e-18 85 30 3 161 3 ureH Urease accessory protein UreH Helicobacter pylori (strain Shi470)
Q5M603 4.42e-18 85 24 9 277 3 ureD Urease accessory protein UreD Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A3DGF4 4.57e-18 85 26 4 217 3 ureD Urease accessory protein UreD Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9ZMZ8 5e-18 85 30 3 161 3 ureH Urease accessory protein UreH Helicobacter pylori (strain J99 / ATCC 700824)
B5Z670 5.2e-18 85 28 3 184 3 ureH Urease accessory protein UreH Helicobacter pylori (strain G27)
Q5M1G2 5.34e-18 85 24 9 277 3 ureD Urease accessory protein UreD Streptococcus thermophilus (strain CNRZ 1066)
Q09067 5.69e-18 85 28 3 189 1 ureH Urease accessory protein UreH Helicobacter pylori (strain ATCC 700392 / 26695)
Q4A0J9 7.15e-18 85 25 7 228 3 ureD Urease accessory protein UreD Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q17VS1 1.58e-17 84 29 3 161 3 ureH Urease accessory protein UreH Helicobacter acinonychis (strain Sheeba)
Q6G728 2.72e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain MSSA476)
A8Z391 2.89e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain USA300 / TCH1516)
Q6GEE0 2.89e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain MRSA252)
A6QJD4 2.89e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain Newman)
Q5HDR4 2.89e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain COL)
A5IV75 2.89e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain JH9)
Q2G272 2.89e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEJ9 2.89e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain USA300)
A6U418 2.89e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain JH1)
Q2YYV1 2.92e-17 83 25 5 210 3 ureD Urease accessory protein UreD Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KG55 6.29e-17 82 28 4 205 3 ureD Urease accessory protein UreD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q4ZUD4 6.48e-17 82 26 5 261 3 ureD1 Urease accessory protein UreD 1 Pseudomonas syringae pv. syringae (strain B728a)
A0JRH8 8.77e-17 82 25 5 279 3 ureD Urease accessory protein UreD Arthrobacter sp. (strain FB24)
Q1CV87 3.99e-16 80 29 3 161 3 ureH Urease accessory protein UreH Helicobacter pylori (strain HPAG1)
Q5HLV7 5.13e-16 80 23 3 205 3 ureD Urease accessory protein UreD Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B1ZBW7 7.64e-16 79 24 4 284 3 ureD1 Urease accessory protein UreD 1 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q8CNC5 8.53e-16 79 23 3 205 3 ureD Urease accessory protein UreD Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B1ZNZ6 8.94e-16 79 26 7 258 3 ureD Urease accessory protein UreD Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q8XXS7 1.51e-15 79 27 7 281 3 ureD Urease accessory protein UreD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A1R1C9 1.67e-15 79 25 8 298 3 ureD Urease accessory protein UreD Paenarthrobacter aurescens (strain TC1)
B0KV00 2.11e-15 78 28 10 295 3 ureD Urease accessory protein UreD Pseudomonas putida (strain GB-1)
A7HHM9 2.18e-15 78 30 7 209 3 ureD Urease accessory protein UreD Anaeromyxobacter sp. (strain Fw109-5)
B1J812 7.5e-15 76 28 10 285 3 ureD Urease accessory protein UreD Pseudomonas putida (strain W619)
Q1IBP3 7.5e-15 76 27 10 291 3 ureD Urease accessory protein UreD Pseudomonas entomophila (strain L48)
Q883F5 2.06e-14 75 23 2 255 3 ureD1 Urease accessory protein UreD 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0CB03 2.15e-14 75 25 5 220 3 ureD Urease accessory protein UreD Ureaplasma urealyticum
B5ZBS5 2.15e-14 75 25 5 220 3 ureD Urease accessory protein UreD Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q473R3 2.96e-14 75 25 7 282 3 ureD Urease accessory protein UreD Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1LPT3 3.65e-14 75 25 8 284 3 ureD Urease accessory protein UreD Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q733K0 5.03e-14 74 25 7 221 3 ureD Urease accessory protein UreD Bacillus cereus (strain ATCC 10987 / NRS 248)
A5U9W0 5.51e-14 74 26 7 257 3 ureD Urease accessory protein UreD Haemophilus influenzae (strain PittEE)
B1M9D6 5.94e-14 74 26 5 259 3 ureD2 Urease accessory protein UreD 2 Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
O30332 6.05e-14 74 25 7 281 3 ureD Urease accessory protein UreD Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q88J07 6.28e-14 74 27 8 290 3 ureD Urease accessory protein UreD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2Y9N0 6.43e-14 74 26 5 278 3 ureD Urease accessory protein UreD Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q56562 1.07e-13 73 24 5 220 3 ureD Urease accessory protein UreD Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ69 1.07e-13 73 24 5 220 3 ureD Urease accessory protein UreD Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q8FQW8 1.23e-13 73 29 9 242 3 ureD Urease accessory protein UreD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A5W4B9 1.84e-13 72 27 9 296 3 ureD Urease accessory protein UreD Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9Z364 2.72e-13 72 27 8 273 3 ureD Urease accessory protein UreD Actinomyces naeslundii
P44397 4.02e-13 71 28 7 216 3 ureD Urease accessory protein UreD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A9GP79 4.22e-13 72 28 5 207 3 ureD Urease accessory protein UreD Sorangium cellulosum (strain So ce56)
A5UH41 6.34e-13 71 28 7 224 3 ureD Urease accessory protein UreD Haemophilus influenzae (strain PittGG)
A9KJR5 8.75e-13 70 22 6 264 3 ureD Urease accessory protein UreD Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B2GI02 1.36e-12 71 32 2 154 3 ureD Urease accessory protein UreD Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q4QN13 2.81e-12 69 26 8 224 3 ureD Urease accessory protein UreD Haemophilus influenzae (strain 86-028NP)
Q9FAS8 3.26e-12 69 24 7 288 3 ureD Urease accessory protein UreD Vibrio parahaemolyticus
Q3M708 7.19e-12 68 23 7 285 3 ureD Urease accessory protein UreD Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q7VRS3 8.96e-12 68 23 6 278 3 ureD Urease accessory protein UreD Blochmanniella floridana
A0L6E9 1.06e-11 67 25 8 304 3 ureD Urease accessory protein UreD Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B2IT63 1.25e-11 67 23 7 287 3 ureD Urease accessory protein UreD Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8YQZ4 1.76e-11 67 24 8 286 3 ureD Urease accessory protein UreD Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7VJ35 1.81e-11 66 31 1 118 3 ureH Urease accessory protein UreH Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A9W1Z5 2.32e-11 67 25 7 274 3 ureD1 Urease accessory protein UreD 1 Methylorubrum extorquens (strain PA1)
A3N2Q9 2.51e-11 66 26 5 202 3 ureD Urease accessory protein UreD Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q0ACA1 3.32e-11 66 25 9 295 3 ureD Urease accessory protein UreD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q2JN19 5.07e-11 65 24 4 205 3 ureD Urease accessory protein UreD Synechococcus sp. (strain JA-2-3B'a(2-13))
Q45347 5.84e-11 65 28 1 138 3 ureD Urease accessory protein UreD Sporosarcina pasteurii
Q79VJ0 7.12e-11 65 35 2 113 2 ureD1 Urease accessory protein UreD Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B1HZE8 8.38e-11 65 24 5 215 3 ureD Urease accessory protein UreD Lysinibacillus sphaericus (strain C3-41)
Q03285 1e-10 64 25 9 282 2 ureD Urease accessory protein UreD Escherichia coli
P17089 1.2e-10 64 23 7 281 1 ureD Urease accessory protein UreD Proteus mirabilis (strain HI4320)
O54425 1.35e-10 64 25 5 202 3 ureD Urease accessory protein UreD Actinobacillus pleuropneumoniae
B3H2K8 1.35e-10 64 25 5 202 3 ureD Urease accessory protein UreD Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q2JWA7 1.51e-10 64 27 4 188 3 ureD2 Urease accessory protein UreD 2 Synechococcus sp. (strain JA-3-3Ab)
B0BRT7 2.06e-10 63 25 5 202 3 ureD Urease accessory protein UreD Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A4QA27 3.55e-10 63 35 2 113 3 ureD Urease accessory protein UreD Corynebacterium glutamicum (strain R)
Q5E725 7e-10 62 23 6 287 3 ureD Urease accessory protein UreD Aliivibrio fischeri (strain ATCC 700601 / ES114)
B0C790 8.26e-10 62 21 5 285 3 ureD Urease accessory protein UreD Acaryochloris marina (strain MBIC 11017)
A5FAE2 9.58e-10 62 24 7 258 3 ureD Urease accessory protein UreD Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A9BUC8 1.17e-09 62 23 7 295 3 ureD Urease accessory protein UreD Delftia acidovorans (strain DSM 14801 / SPH-1)
B5FBC9 1.2e-09 61 23 6 287 3 ureD Urease accessory protein UreD Aliivibrio fischeri (strain MJ11)
Q492E6 1.79e-09 61 24 9 282 3 ureD Urease accessory protein UreD Blochmanniella pennsylvanica (strain BPEN)
A4YV90 2.09e-09 61 24 9 272 3 ureD2 Urease accessory protein UreD 2 Bradyrhizobium sp. (strain ORS 278)
Q3KIS7 2.96e-09 60 26 7 252 3 ureD Urease accessory protein UreD Pseudomonas fluorescens (strain Pf0-1)
A5EJY2 6.56e-09 59 23 8 271 3 ureD2 Urease accessory protein UreD 2 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q47G52 8.7e-09 59 26 8 278 3 ureD Urease accessory protein UreD Dechloromonas aromatica (strain RCB)
Q4KJ05 1.18e-08 58 25 7 257 3 ureD Urease accessory protein UreD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A5GWV3 1.5e-08 58 26 6 230 3 ureD Urease accessory protein UreD Synechococcus sp. (strain RCC307)
A4JC45 1.91e-08 58 25 4 232 3 ureD Urease accessory protein UreD Burkholderia vietnamiensis (strain G4 / LMG 22486)
A6X1Q4 2.21e-08 57 24 7 284 3 ureD2 Urease accessory protein UreD 2 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q1QV50 2.58e-08 58 24 9 285 3 ureD Urease accessory protein UreD Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A4VQU8 3.98e-08 57 27 8 236 3 ureD Urease accessory protein UreD Stutzerimonas stutzeri (strain A1501)
A0K579 5.09e-08 57 24 3 219 3 ureD Urease accessory protein UreD Burkholderia cenocepacia (strain HI2424)
Q7V3V5 6.27e-08 57 23 5 263 3 ureD Urease accessory protein UreD Prochlorococcus marinus (strain MIT 9313)
A1KBB8 6.41e-08 56 24 7 289 3 ureD Urease accessory protein UreD Azoarcus sp. (strain BH72)
A8ESZ6 6.59e-08 56 30 1 91 3 ureD Urease accessory protein UreD Aliarcobacter butzleri (strain RM4018)
P73047 6.66e-08 56 24 4 250 3 ureD Urease accessory protein UreD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1BYG9 6.96e-08 56 24 3 218 3 ureD Urease accessory protein UreD Burkholderia orbicola (strain AU 1054)
E0ZS45 8.43e-08 56 25 5 165 2 URED Urease accessory protein D Oryza sativa subsp. indica
Q0E3I9 8.55e-08 56 25 5 165 3 URED Urease accessory protein D Oryza sativa subsp. japonica
Q144D8 9.72e-08 56 25 5 268 3 ureD Urease accessory protein UreD Paraburkholderia xenovorans (strain LB400)
A2CDZ8 1.29e-07 55 23 5 263 3 ureD Urease accessory protein UreD Prochlorococcus marinus (strain MIT 9303)
P0A4R4 1.37e-07 55 24 5 277 3 ureD Urease accessory protein UreD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4R6 1.37e-07 55 24 5 277 3 ureD Urease accessory protein UreD Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4R5 1.37e-07 55 24 5 277 3 ureD Urease accessory protein UreD Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B1XIC0 1.57e-07 55 23 6 267 3 ureD Urease accessory protein UreD Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P87125 1.67e-07 55 29 6 170 3 SPAC3A12.09c Uncharacterized urease accessory protein ureD-like Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6SZ04 1.93e-07 55 24 4 276 3 ureD Urease accessory protein UreD Janthinobacterium sp. (strain Marseille)
Q39IW0 2.14e-07 55 24 4 250 3 ureD Urease accessory protein UreD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1ZHP3 2.15e-07 55 26 2 148 3 ureD2 Urease accessory protein UreD 2 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A9AZE9 2.33e-07 55 22 9 293 3 ureD Urease accessory protein UreD Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q2SYF4 3.03e-07 54 26 7 201 3 ureD Urease accessory protein UreD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9RYK1 3.35e-07 54 23 6 209 3 ureD Urease accessory protein UreD Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q3IH71 4.7e-07 53 28 6 202 3 ureD Urease accessory protein UreD Pseudoalteromonas translucida (strain TAC 125)
A4XQ48 8.47e-07 53 25 7 273 3 ureD Urease accessory protein UreD Pseudomonas mendocina (strain ymp)
Q0BHN2 8.77e-07 53 23 4 217 3 ureD Urease accessory protein UreD Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A9W6X7 9.16e-07 53 25 3 159 3 ureD3 Urease accessory protein UreD 3 Methylorubrum extorquens (strain PA1)
Q3J767 9.41e-07 53 25 9 278 3 ureD Urease accessory protein UreD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q1QCE3 1.6e-06 52 24 6 258 3 ureD1 Urease accessory protein UreD 1 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A4FCP0 2.18e-06 52 26 3 173 3 ureD2 Urease accessory protein UreD 2 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q63RL6 2.7e-06 51 26 5 193 3 ureD Urease accessory protein UreD Burkholderia pseudomallei (strain K96243)
A3NCL3 2.7e-06 51 26 5 193 3 ureD Urease accessory protein UreD Burkholderia pseudomallei (strain 668)
Q3JPJ9 2.7e-06 51 26 5 193 3 ureD Urease accessory protein UreD Burkholderia pseudomallei (strain 1710b)
A3NYC5 2.7e-06 51 26 5 193 3 ureD Urease accessory protein UreD Burkholderia pseudomallei (strain 1106a)
A1V1H0 2.7e-06 51 26 5 193 3 ureD Urease accessory protein UreD Burkholderia mallei (strain SAVP1)
Q62HS3 2.7e-06 51 26 5 193 3 ureD Urease accessory protein UreD Burkholderia mallei (strain ATCC 23344)
A2S999 2.7e-06 51 26 5 193 3 ureD Urease accessory protein UreD Burkholderia mallei (strain NCTC 10229)
A3MMU8 2.7e-06 51 26 5 193 3 ureD Urease accessory protein UreD Burkholderia mallei (strain NCTC 10247)
A8I4R6 3.19e-06 51 26 4 149 3 ureD Urease accessory protein UreD Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q21P97 4.37e-06 51 26 10 284 3 ureD Urease accessory protein UreD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A4WR71 4.63e-06 50 33 0 102 3 ureD Urease accessory protein UreD Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q2SDQ4 5.73e-06 50 23 8 294 3 ureD Urease accessory protein UreD Hahella chejuensis (strain KCTC 2396)
B9J8M7 5.75e-06 50 27 1 132 3 ureD Urease accessory protein UreD Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q7Y0S0 7.59e-06 50 23 3 160 2 URED Urease accessory protein D Arabidopsis thaliana
Q6N3M9 8.33e-06 50 27 5 191 3 ureD Urease accessory protein UreD Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q133L1 1.04e-05 50 27 4 190 3 ureD Urease accessory protein UreD Rhodopseudomonas palustris (strain BisB5)
A2SDR5 1.43e-05 49 24 7 261 3 ureD Urease accessory protein UreD Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1U501 1.47e-05 49 23 6 255 3 ureD Urease accessory protein UreD Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B0JNA9 2.31e-05 48 22 8 274 3 ureD Urease accessory protein UreD Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q2K511 2.33e-05 48 29 0 98 3 ureD Urease accessory protein UreD Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3AGD3 2.64e-05 48 24 7 243 3 ureD Urease accessory protein UreD Synechococcus sp. (strain CC9605)
A8LRS5 3.61e-05 48 24 7 238 3 ureD Urease accessory protein UreD Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q2IZ53 5.8e-05 47 28 2 139 3 ureD Urease accessory protein UreD Rhodopseudomonas palustris (strain HaA2)
Q0VKX8 6.82e-05 47 24 9 280 3 ureD Urease accessory protein UreD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A7IMY3 6.88e-05 47 28 2 139 3 ureD Urease accessory protein UreD Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q8YF70 7.31e-05 47 25 5 203 3 ureD1 Urease accessory protein UreD 1 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A6VTV5 7.75e-05 47 22 9 295 3 ureD Urease accessory protein UreD Marinomonas sp. (strain MWYL1)
Q9HUU9 8.77e-05 47 24 6 252 3 ureD Urease accessory protein UreD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q57F88 9.18e-05 47 25 5 203 3 ureD1 Urease accessory protein UreD 1 Brucella abortus biovar 1 (strain 9-941)
Q2YPD8 9.18e-05 47 25 5 203 3 ureD1 Urease accessory protein UreD 1 Brucella abortus (strain 2308)
Q1H0E9 0.000107 47 23 7 278 3 ureD Urease accessory protein UreD Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q07K69 0.000114 46 33 2 98 3 ureD Urease accessory protein UreD Rhodopseudomonas palustris (strain BisA53)
A6UC41 0.000115 46 27 0 98 3 ureD Urease accessory protein UreD Sinorhizobium medicae (strain WSM419)
Q02FF5 0.000219 45 23 6 252 3 ureD Urease accessory protein UreD Pseudomonas aeruginosa (strain UCBPP-PA14)
A6VCX1 0.000219 45 23 6 252 3 ureD Urease accessory protein UreD Pseudomonas aeruginosa (strain PA7)
A1B1C3 0.000228 45 24 8 227 3 ureD Urease accessory protein UreD Paracoccus denitrificans (strain Pd 1222)
B1LZY1 0.000372 45 23 4 171 3 ureD1 Urease accessory protein UreD 1 Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q1MCV4 0.000398 45 29 1 109 3 ureD Urease accessory protein UreD Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q11VN0 0.000524 44 21 3 152 3 ureD Urease accessory protein UreD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q3J149 0.000541 44 34 2 104 3 ureD Urease accessory protein UreD Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A5ERV4 0.000543 44 28 0 96 3 ureD3 Urease accessory protein UreD 3 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q89UG4 0.0007 44 29 0 98 3 ureD Urease accessory protein UreD Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q826R6 0.000848 43 24 5 165 3 ureD Urease accessory protein UreD Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15300
Feature type CDS
Gene -
Product urease accessory protein UreD
Location 45152 - 46117 (strand: 1)
Length 966 (nucleotides) / 321 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000005
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1217
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01774 UreD urease accessory protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0829 Posttranslational modification, protein turnover, chaperones (O) O Urease accessory protein UreH

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03190 urease accessory protein - -

Protein Sequence

MTQLRAEITGTPTRLRAHLLGEKAPEMAPYQDEPKQMQSGAIGKSGYLKLRFAKREYRSELAEMERRVPSLVQRALYWDELMPQMPCVTMISTSGCLLQGDRQALDLIVEEGACAHVTTQSATKIHMMEANYATQYQNVVVEAGGYLEFLPDPIIPHRTARFITDTHITIDPTATLLYSEILMSGRKYHHPDEQFGFDIFSSKIRAQDPAGKELFVEKYVLEPKKEPLNVVGVMGGFDVFGNVILLTPKEHHARILERLEARYNTDEEVAFGATQLPNECGLVFKVLGVDSPKTKEAVRYFWQIAREEILGITLQKPFLWR

Flanking regions ( +/- flanking 50bp)

ATGATCATGGATAAATTCCTGTTTACACATCAGGTGGCAGGAGCAAAAGCATGACACAACTGAGGGCTGAGATTACCGGGACGCCAACACGTCTGCGGGCTCATCTCTTAGGGGAAAAGGCGCCGGAAATGGCGCCTTACCAGGATGAGCCGAAGCAAATGCAAAGTGGTGCGATCGGAAAGAGCGGTTATCTGAAACTGCGGTTTGCCAAACGGGAATACCGCAGCGAACTGGCGGAAATGGAACGCCGGGTGCCGTCTCTGGTTCAGCGGGCGCTGTACTGGGACGAACTGATGCCGCAAATGCCGTGCGTAACCATGATTTCAACCTCCGGTTGCCTGTTACAGGGCGACCGGCAGGCGCTGGATCTGATTGTGGAAGAGGGCGCGTGTGCGCATGTCACTACGCAATCTGCGACCAAAATCCACATGATGGAAGCGAACTACGCCACCCAATATCAGAATGTGGTGGTGGAAGCGGGCGGCTATCTGGAGTTTCTGCCGGATCCGATTATTCCGCACCGTACGGCGCGTTTTATTACAGACACGCACATTACGATTGATCCGACGGCAACCCTTCTCTATTCCGAGATCCTGATGTCCGGGCGGAAATATCACCATCCTGATGAGCAGTTCGGGTTTGATATTTTCTCCTCAAAGATCCGCGCGCAAGATCCCGCCGGAAAAGAGTTATTCGTTGAGAAATATGTTCTGGAGCCTAAAAAAGAGCCGCTGAATGTCGTGGGTGTGATGGGCGGGTTTGACGTGTTCGGTAATGTGATTTTACTGACCCCGAAAGAGCATCATGCCCGGATCCTTGAGCGTCTGGAAGCGCGTTATAACACAGATGAAGAGGTCGCGTTCGGGGCAACACAATTACCCAATGAATGCGGACTGGTGTTTAAAGTGCTGGGCGTGGACAGCCCGAAAACCAAAGAAGCGGTTCGTTACTTCTGGCAGATAGCCCGGGAAGAGATCCTCGGGATAACATTGCAAAAGCCGTTCCTGTGGCGCTGATGCGCCATGTGATGATAGCGGCGGTTACTCAGGGGATTGATTGTGCCGGT