Homologs in group_3013

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17660 FBDBKF_17660 90.6 Morganella morganii S1 - ABC-type uncharacterized transport system, permease component
EHELCC_18145 EHELCC_18145 90.6 Morganella morganii S2 - ABC-type uncharacterized transport system, permease component
NLDBIP_18005 NLDBIP_18005 90.6 Morganella morganii S4 - ABC-type uncharacterized transport system, permease component
LHKJJB_18200 LHKJJB_18200 90.6 Morganella morganii S3 - ABC-type uncharacterized transport system, permease component
HKOGLL_18000 HKOGLL_18000 90.6 Morganella morganii S5 - ABC-type uncharacterized transport system, permease component

Distribution of the homologs in the orthogroup group_3013

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3013

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q57341 2.49e-09 61 23 6 275 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q44123 8.55e-09 59 22 5 267 3 fbpB Ferric transport system permease protein FbpB Actinobacillus pleuropneumoniae
P41032 9.61e-08 55 35 0 77 3 cysU Sulfate transport system permease protein CysT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45170 4.14e-07 53 23 6 260 3 potB Spermidine/putrescine transport system permease protein PotB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P16701 4.32e-06 50 26 2 176 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
Q8FW09 2.07e-05 48 27 12 294 3 ugpA sn-glycerol-3-phosphate transport system permease protein UgpA Brucella suis biovar 1 (strain 1330)
Q578E7 2.69e-05 48 27 12 294 3 ugpA sn-glycerol-3-phosphate transport system permease protein UgpA Brucella abortus biovar 1 (strain 9-941)
Q2YKR6 2.69e-05 48 27 12 294 3 ugpA sn-glycerol-3-phosphate transport system permease protein UgpA Brucella abortus (strain 2308)
Q8FYV0 6.14e-05 47 25 4 197 3 thiP Thiamine transport system permease protein ThiP Brucella suis biovar 1 (strain 1330)
O50501 7.78e-05 47 26 7 222 1 ngcG Diacetylchitobiose uptake system permease protein NgcG Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0AFK5 9.51e-05 46 22 6 267 3 potB Spermidine/putrescine transport system permease protein PotB Shigella flexneri
P0AFK4 9.51e-05 46 22 6 267 1 potB Spermidine/putrescine transport system permease protein PotB Escherichia coli (strain K12)
Q2EEX6 0.000128 46 21 3 194 3 cysT Probable sulfate transport system permease protein cysT Helicosporidium sp. subsp. Simulium jonesii
P56343 0.000167 45 28 0 85 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
P0CL49 0.00022 45 21 6 268 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WF94 0.00022 45 21 6 268 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain SL1344)
P0A2J8 0.00022 45 21 6 268 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhi
Q57BC3 0.000358 45 25 4 197 3 thiP Thiamine transport system permease protein ThiP Brucella abortus biovar 1 (strain 9-941)
Q2YLW7 0.000358 45 25 4 197 3 thiP Thiamine transport system permease protein ThiP Brucella abortus (strain 2308)
P55452 0.000409 45 25 8 260 3 NGR_a03680 Probable ABC transporter permease protein y4fN Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8YJ03 0.00053 45 26 3 150 3 thiP Thiamine transport system permease protein ThiP Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P31135 0.000635 44 23 1 175 1 potH Putrescine transport system permease protein PotH Escherichia coli (strain K12)
D4GQ17 0.000636 44 29 0 77 3 HVO_B0370 Probable molybdenum ABC transporter permease protein HVO_B0370 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q53683 0.000839 43 34 1 85 3 None Putative ABC transporter permease protein ORF1 (Fragment) Streptomyces antibioticus
Q9TKU8 0.000852 43 30 1 85 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
Q7AA80 0.001 43 26 10 279 3 ugpA sn-glycerol-3-phosphate transport system permease protein UgpA Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15040
Feature type CDS
Gene -
Product ABC transporter permease subunit
Location 247079 - 247942 (strand: -1)
Length 864 (nucleotides) / 287 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000004
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3013
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4132 General function prediction only (R) R ABC-type uncharacterized transport system, permease component

Protein Sequence

MKKQQQIRVTPRRIALKPMLLLLPAAVLFLLFQLAPMLWVIINSFIYEDAWSFANFSEVFTSPFYIQAFENTLWISGLSSVGGLILAALFAASLQHAPPRPRRWLIAFTNMTGNFSGVPLAFAFVIILGVNGAVTLQLKAWGVIDDFNLYSATGLMLIYLYFQIPLGILLLYPAFDALKPEWEDAAKTMGAGRLAYWRYVALPVLSPALLGTFIILFANAVGAYASTYALTTGNYNMVTIRIASLVSGDLFLEPNMAAALSVLLMVILGFITATYHWLLKRSYHAKC

Flanking regions ( +/- flanking 50bp)

CCTGCTGCGGGAAGATCACCATGGCTGATATTCTGCCGGAGCTGACCGTCATGAAAAAGCAGCAGCAAATCCGCGTAACCCCACGCCGTATTGCGCTGAAACCGATGCTGTTACTGTTGCCTGCGGCAGTGCTGTTTCTGCTCTTTCAGCTTGCACCTATGTTGTGGGTGATTATTAACAGTTTTATTTATGAAGATGCCTGGTCATTCGCTAATTTCAGCGAGGTTTTTACCAGCCCTTTTTATATTCAGGCGTTTGAAAACACCTTATGGATTTCCGGTCTTTCAAGTGTCGGCGGATTAATTCTTGCTGCGCTGTTTGCCGCCTCTCTGCAACATGCACCACCGCGCCCGCGCCGCTGGCTGATTGCCTTTACCAATATGACAGGAAACTTCAGTGGTGTGCCGCTGGCATTTGCGTTTGTGATAATCCTCGGCGTGAACGGGGCAGTCACTCTGCAATTAAAAGCCTGGGGCGTGATTGATGATTTCAATCTCTACAGTGCCACGGGGCTGATGCTGATTTACCTCTATTTTCAGATCCCGCTGGGCATCTTACTGCTCTATCCCGCGTTTGATGCCCTGAAACCGGAATGGGAAGATGCCGCCAAAACCATGGGCGCCGGACGCCTTGCCTACTGGCGCTATGTGGCACTGCCGGTGCTCTCACCCGCGCTGCTCGGCACGTTCATTATTCTGTTCGCCAATGCTGTGGGCGCTTATGCATCCACCTATGCCCTGACGACCGGTAACTACAATATGGTGACGATCCGTATCGCCAGCCTGGTATCAGGGGATTTATTCCTTGAACCCAATATGGCAGCGGCACTATCTGTATTACTGATGGTTATTCTTGGATTTATCACCGCAACATATCATTGGCTGCTGAAACGGAGTTACCATGCCAAGTGCTGATCTTGCCCTGACCCCACCGGCAATTCCCCGTTACCACAAAATCATGCTCA