Homologs in group_2283

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17545 FBDBKF_17545 96.0 Morganella morganii S1 secE preprotein translocase subunit SecE
EHELCC_18030 EHELCC_18030 96.0 Morganella morganii S2 secE preprotein translocase subunit SecE
NLDBIP_18120 NLDBIP_18120 96.0 Morganella morganii S4 secE preprotein translocase subunit SecE
LHKJJB_18315 LHKJJB_18315 96.0 Morganella morganii S3 secE preprotein translocase subunit SecE
HKOGLL_17885 HKOGLL_17885 96.0 Morganella morganii S5 secE preprotein translocase subunit SecE
PMI_RS13785 PMI_RS13785 76.0 Proteus mirabilis HI4320 secE preprotein translocase subunit SecE

Distribution of the homologs in the orthogroup group_2283

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2283

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A2D3 2.57e-60 184 73 0 125 3 secE Protein translocase subunit SecE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D4 2.57e-60 184 73 0 125 3 secE Protein translocase subunit SecE Salmonella typhi
P0AG96 4.32e-54 168 72 0 125 1 secE Protein translocase subunit SecE Escherichia coli (strain K12)
P0AG97 4.32e-54 168 72 0 125 3 secE Protein translocase subunit SecE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AG98 4.32e-54 168 72 0 125 3 secE Protein translocase subunit SecE Escherichia coli O157:H7
Q9KV36 7.49e-43 140 57 0 120 3 secE Protein translocase subunit SecE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9ZNE7 7.92e-35 119 57 0 120 3 secE Protein translocase subunit SecE Vibrio alginolyticus
P57152 1.29e-22 88 30 0 124 3 secE Protein translocase subunit SecE Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8KA64 4.59e-22 87 31 0 124 3 secE Protein translocase subunit SecE Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P43805 4.5e-18 76 37 1 102 3 secE Protein translocase subunit SecE Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HWC3 1.84e-17 75 48 1 94 3 secE Protein translocase subunit SecE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89B14 2.85e-14 67 33 0 109 3 secE Protein translocase subunit SecE Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14930
Feature type CDS
Gene secE
Product preprotein translocase subunit SecE
Location 219578 - 219955 (strand: 1)
Length 378 (nucleotides) / 125 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2283
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00584 SecE/Sec61-gamma subunits of protein translocation complex

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0690 Intracellular trafficking, secretion, and vesicular transport (U) U Preprotein translocase subunit SecE

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03073 preprotein translocase subunit SecE Quorum sensing
Protein export
Bacterial secretion system		 -

Protein Sequence

MSANSEAQQNGRSADVAKWLVVAVLLVAAIGGNYYFREFNLALRALAVVVIIALAGGIALWTTKGKATLTFAREARVEMRKVIWPTRQETLQTTLIVAAVTAVMSLVLWGLDGILVRLVSYITSF

Flanking regions ( +/- flanking 50bp)

GTAGCGAGGCAAGCTGGCTAACTTATTATTTCATGGTTACAGGTTGGTTTATGAGTGCGAATAGCGAAGCTCAACAAAACGGCCGCAGTGCCGATGTCGCCAAATGGTTAGTGGTTGCAGTTCTGCTGGTTGCCGCCATTGGCGGAAACTACTATTTCCGCGAATTTAACCTTGCGCTGCGTGCGCTGGCAGTCGTTGTTATCATTGCATTAGCCGGTGGTATTGCACTGTGGACAACAAAAGGCAAAGCGACACTGACTTTCGCCCGTGAAGCACGGGTTGAAATGCGTAAAGTTATCTGGCCTACACGTCAGGAAACACTGCAAACAACACTTATCGTGGCAGCAGTAACAGCGGTTATGTCGTTAGTGTTATGGGGCCTTGATGGTATCCTTGTCCGTCTTGTTTCCTATATAACATCCTTCTGAGGTTCTAAAGATGTCGGATTCTCCTAAAAAACGTTGGTATGTCATCCAGG