Homologs in group_1738

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12125 FBDBKF_12125 82.6 Morganella morganii S1 yihI Der GTPase-activating protein YihI
EHELCC_14180 EHELCC_14180 82.6 Morganella morganii S2 yihI Der GTPase-activating protein YihI
NLDBIP_15275 NLDBIP_15275 82.6 Morganella morganii S4 yihI Der GTPase-activating protein YihI
LHKJJB_15335 LHKJJB_15335 82.6 Morganella morganii S3 yihI Der GTPase-activating protein YihI
HKOGLL_14455 HKOGLL_14455 82.6 Morganella morganii S5 yihI Der GTPase-activating protein YihI
PMI_RS14425 PMI_RS14425 60.7 Proteus mirabilis HI4320 yihI Der GTPase-activating protein YihI

Distribution of the homologs in the orthogroup group_1738

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1738

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N9T4 5.82e-44 145 55 6 171 3 yihI Der GTPase-activating protein YihI Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2VFA0 6.37e-40 136 49 3 165 3 yihI Der GTPase-activating protein YihI Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q66GG2 1.12e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSG5 1.12e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pestis (strain Pestoides F)
Q1CN50 1.12e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYI1 1.12e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJR9 1.12e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pestis
B2JYK6 1.12e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C238 1.12e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pestis bv. Antiqua (strain Antiqua)
A7FCP6 1.12e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JR11 1.31e-39 135 51 5 171 3 yihI Der GTPase-activating protein YihI Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7MMT5 3.85e-38 131 50 2 164 3 yihI Der GTPase-activating protein YihI Cronobacter sakazakii (strain ATCC BAA-894)
A1JHT5 7.75e-38 130 54 3 146 3 yihI Der GTPase-activating protein YihI Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A9MIV9 5.93e-35 123 48 2 161 3 yihI Der GTPase-activating protein YihI Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4WGC4 3.7e-34 121 48 3 168 3 yihI Der GTPase-activating protein YihI Enterobacter sp. (strain 638)
P0A2N8 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2N9 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella typhi
B4TPL3 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella schwarzengrund (strain CVM19633)
C0Q3G9 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella paratyphi C (strain RKS4594)
A9MYC8 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZ99 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella newport (strain SL254)
B4TBT9 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella heidelberg (strain SL476)
B5QW98 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella enteritidis PT4 (strain P125109)
B5FNZ3 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella dublin (strain CT_02021853)
Q57HL1 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella choleraesuis (strain SC-B67)
B5EZX4 1.36e-31 114 50 1 140 3 yihI Der GTPase-activating protein YihI Salmonella agona (strain SL483)
C6DJE0 3.1e-30 111 51 2 144 3 yihI Der GTPase-activating protein YihI Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GLI7 4.02e-29 108 51 4 162 3 yihI Der GTPase-activating protein YihI Serratia proteamaculans (strain 568)
Q6DB75 1.89e-28 107 49 2 170 3 yihI Der GTPase-activating protein YihI Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8X8G9 1.97e-27 103 48 3 166 3 yihI Der GTPase-activating protein YihI Escherichia coli O157:H7
B1LMP8 1.52e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli (strain SMS-3-5 / SECEC)
B7NV06 1.52e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q1R447 1.67e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli (strain UTI89 / UPEC)
B7N2G7 1.67e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O81 (strain ED1a)
Q3YVA7 2.05e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Shigella sonnei (strain Ss046)
Q8FBG9 2.05e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAJ5 2.05e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A8H7 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Shigella flexneri
Q31UC9 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Shigella boydii serotype 4 (strain Sb227)
B2TVL2 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I4K3 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli (strain SE11)
B7NFG1 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8H6 2.21e-26 101 48 4 162 1 yihI Der GTPase-activating protein YihI Escherichia coli (strain K12)
B1XAM2 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli (strain K12 / DH10B)
C5A034 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli (strain K12 / MC4100 / BW2952)
B7M664 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O8 (strain IAI1)
B7UNI8 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZU67 2.21e-26 101 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MHE5 3.13e-26 100 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O45:K1 (strain S88 / ExPEC)
B7L9B9 4.23e-26 100 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli (strain 55989 / EAEC)
P95508 1.37e-25 99 43 3 144 3 yihI Der GTPase-activating protein YihI Mannheimia haemolytica
A0KEY2 2.46e-25 99 45 5 153 3 yihI Der GTPase-activating protein YihI Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4ST45 3.36e-25 99 44 4 143 3 yihI Der GTPase-activating protein YihI Aeromonas salmonicida (strain A449)
A1AI48 8.44e-25 97 48 4 162 3 yihI Der GTPase-activating protein YihI Escherichia coli O1:K1 / APEC
A6VLB1 4.67e-23 93 37 5 167 3 yihI Der GTPase-activating protein YihI Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0BPQ7 1.58e-19 84 42 4 152 3 yihI Der GTPase-activating protein YihI Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N0X3 1.58e-19 84 42 4 152 3 yihI Der GTPase-activating protein YihI Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3GXV7 2.14e-19 83 42 4 152 3 yihI Der GTPase-activating protein YihI Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A5UHM6 2.79e-19 83 38 2 138 3 yihI Der GTPase-activating protein YihI Haemophilus influenzae (strain PittGG)
A5UE01 2.79e-19 83 38 2 138 3 yihI Der GTPase-activating protein YihI Haemophilus influenzae (strain PittEE)
Q4QMH2 2.79e-19 83 38 2 138 3 yihI Der GTPase-activating protein YihI Haemophilus influenzae (strain 86-028NP)
P44844 2.74e-18 80 37 2 138 3 yihI Der GTPase-activating protein YihI Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VKZ7 3.87e-18 80 38 6 167 3 yihI Der GTPase-activating protein YihI Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9CK03 2.81e-16 75 40 3 153 3 yihI Der GTPase-activating protein YihI Pasteurella multocida (strain Pm70)
Q65W23 2.87e-15 72 38 3 145 3 yihI Der GTPase-activating protein YihI Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B7VHD5 1.2e-14 71 44 4 132 3 yihI Der GTPase-activating protein YihI Vibrio atlanticus (strain LGP32)
Q6LLQ8 1.26e-14 70 38 4 141 3 yihI Der GTPase-activating protein YihI Photobacterium profundum (strain SS9)
Q0I282 4.03e-14 69 43 2 102 3 yihI Der GTPase-activating protein YihI Histophilus somni (strain 129Pt)
Q7MQ19 5.7e-13 66 46 2 89 3 yihI Der GTPase-activating protein YihI Vibrio vulnificus (strain YJ016)
Q8DDR1 5.7e-13 66 46 2 89 3 yihI Der GTPase-activating protein YihI Vibrio vulnificus (strain CMCP6)
A7MTV7 9.33e-13 65 44 3 98 3 yihI Der GTPase-activating protein YihI Vibrio campbellii (strain ATCC BAA-1116)
Q5E8S3 9.4e-13 65 36 4 151 3 yihI Der GTPase-activating protein YihI Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8E8D7 1.16e-12 65 34 5 158 3 yihI Der GTPase-activating protein YihI Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
C3LPV6 1.53e-12 65 43 2 96 3 yihI Der GTPase-activating protein YihI Vibrio cholerae serotype O1 (strain M66-2)
Q9KVM7 1.53e-12 65 43 2 96 3 yihI Der GTPase-activating protein YihI Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4H7 1.53e-12 65 43 2 96 3 yihI Der GTPase-activating protein YihI Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B5FFA9 2.87e-12 64 35 4 151 3 yihI Der GTPase-activating protein YihI Aliivibrio fischeri (strain MJ11)
Q87TF6 1.47e-10 60 46 2 82 3 yihI Der GTPase-activating protein YihI Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14515
Feature type CDS
Gene yihI
Product Der GTPase-activating protein YihI
Location 133067 - 133570 (strand: 1)
Length 504 (nucleotides) / 167 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1738
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04220 Der GTPase activator (YihI)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3078 Translation, ribosomal structure and biogenesis (J) J Ribosome assembly protein YihI, activator of Der GTPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09894 uncharacterized protein - -

Protein Sequence

MAAIQKKPARSRTTKKSREELNTEGRERKQQKKHRGNPSGARQQDNTRKGGRGTDNAVADPRIGSKKPVPLIVEAKTSAKSAVKKPAEPAKIKLSPQDELTKLENDERLDALLLRLEQDETLNADENAYVDTMLERIDTLMAELGISLDEDDDEEKTDDIMQLLKGR

Flanking regions ( +/- flanking 50bp)

TATGAATGCTAACACATATTAATTTGTTATTTTTTAAGCGAGTAAGATATATGGCCGCTATTCAGAAAAAACCAGCCCGGTCACGGACAACGAAAAAAAGCCGTGAAGAGCTCAACACGGAAGGCCGTGAACGTAAGCAGCAGAAAAAGCATCGCGGTAATCCATCCGGTGCCCGCCAGCAGGATAATACCCGCAAAGGTGGTCGTGGTACGGATAATGCCGTAGCTGATCCACGTATCGGCAGTAAAAAACCGGTTCCGCTTATCGTTGAAGCTAAAACGTCTGCCAAATCTGCTGTTAAAAAACCGGCTGAACCGGCAAAAATCAAATTATCGCCTCAGGATGAGCTGACAAAACTCGAGAACGACGAGCGCCTCGATGCGTTACTGTTACGTCTTGAGCAGGACGAAACCCTGAATGCAGATGAAAACGCCTATGTGGATACCATGCTGGAACGCATTGATACCCTGATGGCAGAGCTCGGTATTTCTCTTGATGAAGATGATGACGAAGAGAAAACCGATGACATCATGCAGCTCCTGAAAGGACGCTGATCCGTTATTGCGATTATTAGCATCGCGTAACGAATGCAATACAGTATTAG