Homologs in group_4455

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4455

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4455

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P75856 3.17e-33 122 33 4 218 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
P42914 7.96e-33 121 34 5 224 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
Q8X5E4 1.23e-32 121 31 3 217 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P37923 4.57e-31 117 39 4 197 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P62609 2.24e-28 110 34 7 229 1 focC Chaperone protein FocC Escherichia coli
P62610 2.24e-28 110 34 7 229 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59590 5e-26 104 31 7 229 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P31697 7.16e-26 103 31 7 229 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P35757 1.79e-23 97 34 8 229 3 hifB Chaperone protein HifB Haemophilus influenzae
P46004 1.96e-23 97 28 6 218 3 aggD Chaperone protein AggD Escherichia coli
P77249 2.48e-23 97 32 6 224 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P53516 3.26e-23 97 32 7 206 3 afaB Chaperone protein AfaB Escherichia coli
P25402 2.51e-22 94 29 5 232 3 fanE Chaperone protein FanE Escherichia coli
P45991 2.6e-22 94 32 7 236 3 hifB Chaperone protein HifB Haemophilus influenzae
Q8X5K6 5.74e-22 93 31 7 233 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P69966 3.51e-21 92 25 4 242 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 3.51e-21 92 25 4 242 3 psaB Chaperone protein PsaB Yersinia pestis
P33409 9.73e-21 90 32 9 228 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P15483 1.55e-20 89 30 5 203 3 None Chaperone protein CS3-1 Escherichia coli
P46738 4.97e-20 88 30 7 206 3 nfaE Chaperone protein NfaE Escherichia coli
P33407 1.26e-19 87 25 4 239 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P43661 2.07e-19 86 31 6 219 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26926 3.37e-19 86 29 6 236 1 caf1M Chaperone protein caf1M Yersinia pestis
P77599 1.15e-17 82 33 6 157 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P53519 1.81e-17 81 32 8 231 3 cssC Chaperone protein CssC Escherichia coli
P75749 6.18e-17 80 27 5 196 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P53518 1.58e-16 79 32 8 231 3 cssC Chaperone protein CssC Escherichia coli
P53520 2.83e-16 78 30 6 191 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P40876 4.08e-16 77 25 6 234 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P33128 1.08e-14 74 28 9 235 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P77616 4.08e-14 72 27 9 223 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P21646 7.46e-14 71 26 8 221 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P15319 8.12e-14 71 28 8 232 1 papD Chaperone protein PapD Escherichia coli
P33387 1.54e-11 65 31 4 165 3 sefB Chaperone protein SefB Salmonella enteritidis
P33342 3.17e-11 64 27 7 231 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P25401 9.2e-08 54 23 3 175 1 faeE Chaperone protein FaeE Escherichia coli
Q05433 1.75e-07 53 23 3 175 3 clpE Chaperone protein ClpE Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13305
Feature type CDS
Gene -
Product molecular chaperone
Location 290165 - 290863 (strand: 1)
Length 699 (nucleotides) / 232 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000003
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_4455
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07346 fimbrial chaperone protein Two-component system -

Protein Sequence

MKYILIPFLLLMTLSAHANTAGMSFQLGALRVVYNEGQKSAPLDLINNSPDTPILTQTIITDDPKGKAVNDFKVIPPLTKVLPGSSNQIKIIQINRNLPADRESLFYINSKALSAANKNNDENSAVGGGINIGIASVIKLFYRPANLPVTVDDAQKNLTFSVTDKKLTITNPSPYYINLINVKVGSENIVISEKPMLAPFEKHSYLLNKMLTDKKIKWTIINDAGGLLEFTR

Flanking regions ( +/- flanking 50bp)

ATTACCCGGAAGACTGTGTATATCCCTCCCTCTTTAATACGAAAAAAAAAATGAAATATATATTAATCCCTTTTCTTTTACTTATGACATTATCTGCTCATGCGAACACAGCAGGCATGTCATTCCAGTTAGGCGCACTGCGGGTTGTCTATAATGAGGGGCAAAAAAGTGCTCCGCTGGATCTCATTAACAACTCTCCGGATACGCCTATTCTGACACAGACGATAATTACTGATGATCCGAAAGGAAAAGCAGTAAATGACTTCAAAGTTATTCCGCCATTAACTAAAGTATTACCGGGATCATCTAATCAGATTAAGATAATCCAGATAAACAGGAACTTGCCTGCGGACAGGGAATCACTTTTTTATATAAACAGCAAAGCACTGAGTGCTGCGAATAAAAATAATGATGAGAATAGCGCTGTAGGTGGTGGCATTAATATCGGAATCGCATCTGTTATTAAACTATTTTACAGACCAGCTAACCTTCCGGTAACAGTAGATGACGCACAAAAAAACCTTACATTTTCCGTCACTGATAAAAAACTTACTATTACAAACCCATCACCTTATTACATTAATTTAATCAATGTAAAAGTAGGCAGTGAAAATATTGTCATTTCAGAAAAACCAATGCTTGCGCCATTTGAAAAGCATTCATACCTGCTGAATAAAATGCTCACTGACAAAAAAATAAAATGGACAATTATCAATGATGCTGGTGGCTTGCTGGAATTTACCCGTTAACATAAAAAAAACAATTATCAGTTTATTGATATTATTACCATTTTTCCAAG