Homologs in group_114

Help

10 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03405 FBDBKF_03405 41.7 Morganella morganii S1 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
FBDBKF_07910 FBDBKF_07910 94.8 Morganella morganii S1 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
EHELCC_07130 EHELCC_07130 41.7 Morganella morganii S2 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
EHELCC_13740 EHELCC_13740 94.8 Morganella morganii S2 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
NLDBIP_07455 NLDBIP_07455 41.7 Morganella morganii S4 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
NLDBIP_14185 NLDBIP_14185 94.8 Morganella morganii S4 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
LHKJJB_06990 LHKJJB_06990 41.7 Morganella morganii S3 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
LHKJJB_08665 LHKJJB_08665 94.8 Morganella morganii S3 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
HKOGLL_03940 HKOGLL_03940 41.7 Morganella morganii S5 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
HKOGLL_08215 HKOGLL_08215 94.8 Morganella morganii S5 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase

Distribution of the homologs in the orthogroup group_114

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_114

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A5UMN6 1.77e-35 141 27 14 441 3 dadD 5'-deoxyadenosine deaminase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q67NQ5 2.73e-34 137 28 17 471 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B7JJI0 3.03e-31 129 26 13 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH820)
Q81S14 3.03e-31 129 26 13 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis
C3L6N3 3.03e-31 129 26 13 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P768 3.03e-31 129 26 13 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain A0248)
Q8PUQ3 1.21e-30 127 25 14 460 3 dadD 5'-deoxyadenosine deaminase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
C1EPN0 2.73e-30 126 26 13 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain 03BB102)
Q2LTB7 3.69e-30 126 25 15 460 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Syntrophus aciditrophicus (strain SB)
A0RCM7 4.96e-30 125 26 13 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis (strain Al Hakam)
Q12WS1 5.09e-30 125 24 12 447 3 dadD 5'-deoxyadenosine deaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
B7HMN9 1.17e-29 124 26 12 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH187)
Q6HK87 1.75e-29 124 25 12 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CU1 1.75e-29 124 25 12 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ZK / E33L)
B0K2W0 1.95e-29 124 25 14 460 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter sp. (strain X514)
B0K8R8 1.95e-29 124 25 14 460 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B7HIQ2 2.04e-29 124 26 13 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain B4264)
O31352 2.52e-29 123 26 12 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q466Q9 6.04e-29 122 26 13 454 3 dadD 5'-deoxyadenosine deaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
B7IS56 9.21e-29 122 25 12 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain G9842)
Q81F14 1.11e-28 121 25 12 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7GNR9 1.06e-27 119 25 12 426 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8TRA4 1.22e-27 118 25 14 453 3 dadD 5'-deoxyadenosine deaminase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A0LMI3 2.97e-27 117 23 16 459 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q5WGA8 6.04e-27 116 25 12 456 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Shouchella clausii (strain KSM-K16)
Q0AYV2 1.03e-26 115 25 12 442 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q3AC64 6.87e-26 113 25 13 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B5YDN9 3.37e-24 108 24 12 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A3DEQ2 5.31e-24 108 24 11 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8R9L4 7.05e-24 107 24 13 425 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2RJW1 8.37e-24 107 24 10 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2LUH4 8.8e-24 107 24 14 466 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Syntrophus aciditrophicus (strain SB)
A4J675 9.59e-24 107 23 10 426 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A9A9H3 1.05e-23 107 21 12 456 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q8U0P7 2.05e-23 106 25 15 448 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A6VH76 2.1e-23 106 22 12 456 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q9EYU0 2.27e-23 106 24 11 452 1 triA Melamine deaminase Paracidovorax citrulli
A6UQD4 2.37e-23 105 21 11 456 3 dadD 5'-deoxyadenosine deaminase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A5D1G6 3.34e-23 105 24 13 456 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
O27549 4.2e-23 105 25 13 422 3 dadD 5'-deoxyadenosine deaminase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q58936 7.17e-23 104 22 13 456 1 dadD 5'-deoxyadenosine deaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A4FW32 1.53e-22 103 21 12 456 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
B8E183 2.32e-22 103 23 12 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
P72156 3.97e-22 102 24 11 452 1 atzA Atrazine chlorohydrolase Pseudomonas sp. (strain ADP)
Q6LX61 4.16e-22 102 21 12 456 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q8TYD4 4.98e-22 102 23 14 441 3 dadD 5'-deoxyadenosine deaminase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
B1I2P4 7.76e-22 101 24 12 456 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforudis audaxviator (strain MP104C)
B8DKS6 1.05e-21 101 23 13 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A1VD37 2.29e-21 100 24 14 458 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DP4)
Q891Y7 3.59e-21 99 24 14 448 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Clostridium tetani (strain Massachusetts / E88)
Q72B14 7.43e-21 99 24 15 460 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9V0Y5 2.09e-19 94 20 12 426 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q2NHL6 4.75e-19 93 24 11 400 3 dadD 5'-deoxyadenosine deaminase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q1MR44 7.04e-19 92 23 16 465 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Lawsonia intracellularis (strain PHE/MN1-00)
O59184 2.32e-18 90 21 14 446 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
B8FRL9 2.5e-18 90 24 17 418 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B5YLB7 2.5e-18 91 23 12 458 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q24UA2 2.78e-18 90 24 17 418 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain Y51)
A6UUG9 8.88e-18 89 19 10 419 3 dadD 5'-deoxyadenosine deaminase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
B8CX03 1.55e-17 88 23 14 473 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B6YUF8 1.78e-17 88 23 19 474 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus onnurineus (strain NA1)
A7I6C5 2.76e-17 87 24 15 417 3 dadD 5'-deoxyadenosine deaminase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A4XJI3 4.17e-17 87 22 12 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q9KC82 6.17e-17 86 24 12 410 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5JER0 3.7e-16 84 22 15 456 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B8J2Q8 4.79e-16 84 24 16 452 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q9X034 8.27e-16 83 23 9 356 1 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
C5BSJ0 2.94e-15 81 23 13 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A0B7V2 5.72e-15 80 22 15 431 3 dadD 5'-deoxyadenosine deaminase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
C6A048 9.22e-15 80 23 16 468 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q92342 2.06e-14 79 23 14 472 3 SPAC1F8.04c Uncharacterized protein C1F8.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O29701 3.32e-14 78 23 15 408 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q3ITF7 4.09e-14 78 23 9 380 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q5UYR3 2.26e-13 75 22 14 406 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
O29265 5.04e-13 74 23 15 435 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O66851 5.1e-13 74 21 10 409 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Aquifex aeolicus (strain VF5)
Q9HN51 2e-12 72 25 11 316 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P0CI72 1.15e-11 70 22 17 388 1 None Isoxanthopterin deaminase Unknown prokaryotic organism
Q2FRU6 6.1e-11 68 21 12 385 3 dadD 5'-deoxyadenosine deaminase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q21IS0 4.73e-10 65 23 16 456 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
P76641 2e-09 63 22 14 418 1 guaD Guanine deaminase Escherichia coli (strain K12)
Q52725 2.58e-09 63 27 5 205 1 trzA S-triazine hydrolase Gordonia rubripertincta
A1SPZ7 6.18e-09 61 23 17 442 3 hutI Imidazolonepropionase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q18EV7 8.81e-09 61 21 13 422 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q6MJP9 1.25e-08 60 22 14 399 3 hutI Imidazolonepropionase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q7MX82 5.5e-07 55 23 17 417 3 hutI Imidazolonepropionase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B1VUR8 5.7e-07 55 24 16 407 3 hutI Imidazolonepropionase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B2RLA8 5.95e-07 55 23 17 417 3 hutI Imidazolonepropionase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q86AW9 2.86e-06 53 23 16 382 1 guaD Guanine deaminase Dictyostelium discoideum
A8M4I4 7.7e-06 52 23 12 413 3 hutI Imidazolonepropionase Salinispora arenicola (strain CNS-205)
Q46812 1.2e-05 51 25 1 102 1 ssnA Putative aminohydrolase SsnA Escherichia coli (strain K12)
O14057 1.65e-05 51 23 12 353 3 SPCC1672.03c Probable guanine deaminase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B2VC08 1.69e-05 50 41 2 65 3 hutI Imidazolonepropionase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9HLJ0 2.51e-05 50 21 13 389 3 hutI Imidazolonepropionase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9KZ78 3.93e-05 49 41 2 63 3 hutI Imidazolonepropionase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0JUI7 4.05e-05 49 42 2 64 3 hutI Imidazolonepropionase Arthrobacter sp. (strain FB24)
O27075 0.000106 48 24 8 216 3 MTH_994 Putative aminohydrolase MTH_994 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A1R4S6 0.000121 48 38 2 70 3 hutI Imidazolonepropionase Paenarthrobacter aurescens (strain TC1)
Q5RAV9 0.000357 47 22 2 149 2 GDA Guanine deaminase Pongo abelii
Q9Y2T3 0.000403 46 22 2 149 1 GDA Guanine deaminase Homo sapiens
B9KSW5 0.000469 46 32 0 80 3 hutI Imidazolonepropionase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A4FNE8 0.000613 45 40 1 59 3 hutI Imidazolonepropionase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q1GSH1 0.000614 46 24 18 408 3 hutI Imidazolonepropionase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q5QV40 0.000757 45 31 5 129 3 hutI Imidazolonepropionase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0BZK3 0.000882 45 30 5 146 3 hutI Imidazolonepropionase Hyphomonas neptunium (strain ATCC 15444)
B7GUU8 0.001 45 22 14 396 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain AB307-0294)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13075
Feature type CDS
Gene -
Product amidohydrolase family protein
Location 231056 - 232672 (strand: -1)
Length 1617 (nucleotides) / 538 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_114
Orthogroup size 11
N. genomes 6

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0402 Nucleotide transport and metabolism (F)
General function prediction only (R)		 FR Cytosine/adenosine deaminase or related metal-dependent hydrolase

Protein Sequence

MTDKAQDPSRRSFLKNAGIGTMGLAAGAIGSHSALAGGNPVLTGADDKNKTYIKTDKRKKLIYNGYLITMDEEYGDIEDGAVLVDGDKIIDVGPVSKFAGVDAELIDADGGIILPGVIDSHRHTWMSLLRGISADMSLAGFLGSTFYGIGSVMEAEDIRMAALVGSVEALNAGVTTILDCCDCVNSPDHAPAAIESLRASGIRSIYAYGMQAYDFKGPNRFRSHQQRLDVMKQMHQQYYGSGNKTLNQMGVLLSDFGTLPFADTAKEIELANELGIFVASHTGAAEKSILLKGLHELQHNNLLKPGHLHIHCTSLDNSEWKILKDTGGKVSIAPETEMQMGMGRPPFRASIDHGFKPGLSSDIVCVGSGDLFSQMRLGLQFQRCMDSEAEANRTGKTTTKISLGVRDALTWATHGSAEAMGMEKEIGSITKGKKADIVIVSQKEAFVPSSYPAGSVVLQTTASGVDTVIVNGDVKKRFGKLTQQNTDKIRSDATEALGRIQHAAKKLPKQTAEEVAKFFDAAQDQARENFSAGYSYKK

Flanking regions ( +/- flanking 50bp)

CTTACTTGTGCGTTGATAACTAACAGTGCGATAAGCGGAGTAATAACGAAATGACAGATAAAGCGCAGGATCCTTCAAGACGATCTTTTCTGAAAAATGCCGGGATCGGGACGATGGGGCTGGCAGCCGGGGCTATCGGCAGTCACTCAGCGTTGGCCGGTGGTAACCCGGTATTGACAGGCGCGGATGATAAAAACAAAACCTATATTAAGACTGATAAACGTAAAAAGCTGATTTATAACGGCTATCTCATCACTATGGATGAGGAATACGGGGATATTGAAGACGGCGCAGTGCTGGTTGATGGCGACAAAATTATTGATGTGGGTCCGGTTTCAAAATTTGCCGGTGTGGATGCTGAACTGATTGATGCTGATGGCGGCATTATTCTGCCGGGTGTTATCGACAGTCACCGCCACACCTGGATGTCTCTGCTGCGTGGGATCTCGGCAGATATGTCACTGGCGGGCTTTCTTGGCTCCACGTTTTATGGTATCGGCTCCGTGATGGAAGCAGAAGATATTCGTATGGCGGCATTGGTTGGCTCAGTGGAAGCACTGAATGCCGGTGTAACAACTATTCTCGACTGCTGCGACTGTGTGAACTCACCTGATCACGCACCGGCGGCAATTGAATCCCTGCGCGCATCCGGGATCCGCAGTATCTATGCCTACGGTATGCAGGCGTATGACTTTAAAGGTCCGAACCGTTTCCGCAGCCATCAGCAGCGCCTGGATGTGATGAAACAGATGCATCAGCAATATTATGGCTCCGGCAATAAAACCCTGAACCAGATGGGTGTCCTGCTGAGTGATTTCGGGACACTGCCGTTTGCAGATACCGCAAAAGAGATCGAACTGGCAAATGAACTGGGTATTTTTGTAGCATCTCACACCGGGGCGGCAGAAAAATCAATCCTGCTCAAAGGCCTGCATGAGCTGCAACACAATAACCTGCTGAAACCGGGACATTTACATATCCACTGTACTTCTCTGGATAACAGCGAGTGGAAAATCCTCAAAGATACCGGCGGTAAAGTCTCTATCGCGCCGGAAACCGAAATGCAGATGGGGATGGGGCGTCCGCCGTTCCGTGCCAGTATCGATCACGGCTTCAAACCGGGTCTGAGCAGTGACATCGTGTGTGTTGGTTCAGGCGACCTCTTCTCGCAGATGCGTCTGGGGCTGCAATTCCAGCGCTGCATGGATTCTGAGGCAGAAGCAAACCGTACCGGAAAAACCACGACAAAAATTAGTTTAGGCGTACGCGATGCGCTGACCTGGGCAACACACGGCAGTGCGGAAGCGATGGGGATGGAGAAAGAGATCGGCTCAATTACCAAAGGTAAAAAAGCCGATATCGTGATTGTTTCTCAGAAAGAAGCCTTTGTACCATCGAGCTATCCGGCGGGCTCTGTTGTATTACAGACCACGGCGTCCGGGGTGGATACCGTTATTGTGAATGGTGATGTGAAAAAACGCTTTGGTAAACTGACACAGCAGAACACGGATAAAATCCGTTCTGATGCGACAGAAGCACTGGGTCGTATTCAGCACGCCGCGAAAAAATTGCCGAAACAAACCGCAGAAGAAGTGGCAAAATTCTTTGATGCCGCGCAGGATCAGGCACGCGAGAACTTCTCAGCCGGTTACAGTTATAAAAAATAAATAAACGTAAGCAGTGGCTAAAAGAACCGCACCATTTTGGTGCGGTTTTT