Homologs in group_1871

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13975 FBDBKF_13975 96.7 Morganella morganii S1 pyrG CTP synthase (glutamine hydrolyzing)
EHELCC_11650 EHELCC_11650 96.7 Morganella morganii S2 pyrG CTP synthase (glutamine hydrolyzing)
NLDBIP_11990 NLDBIP_11990 96.7 Morganella morganii S4 pyrG CTP synthase (glutamine hydrolyzing)
LHKJJB_11850 LHKJJB_11850 96.7 Morganella morganii S3 pyrG CTP synthase (glutamine hydrolyzing)
HKOGLL_10465 HKOGLL_10465 96.7 Morganella morganii S5 pyrG CTP synthase (glutamine hydrolyzing)
PMI_RS01060 PMI_RS01060 91.0 Proteus mirabilis HI4320 pyrG CTP synthase (glutamine hydrolyzing)

Distribution of the homologs in the orthogroup group_1871

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1871

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EUF6 0 1008 91 0 545 3 pyrG CTP synthase Proteus mirabilis (strain HI4320)
A8G9W0 0 991 88 0 545 3 pyrG CTP synthase Serratia proteamaculans (strain 568)
B2VFY9 0 979 87 0 545 3 pyrG CTP synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A1JJR3 0 978 88 0 545 3 pyrG CTP synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JK10 0 975 87 0 545 3 pyrG CTP synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66ED9 0 975 87 0 545 3 pyrG CTP synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPY0 0 975 87 0 545 3 pyrG CTP synthase Yersinia pestis (strain Pestoides F)
Q1CLT3 0 975 87 0 545 3 pyrG CTP synthase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1D2 0 975 87 0 545 3 pyrG CTP synthase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBN1 0 975 87 0 545 3 pyrG CTP synthase Yersinia pestis
B2K560 0 975 87 0 545 3 pyrG CTP synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C3Y5 0 975 87 0 545 3 pyrG CTP synthase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLZ6 0 975 87 0 545 3 pyrG CTP synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A9MF10 0 973 87 0 541 3 pyrG CTP synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6TD54 0 972 87 0 541 3 pyrG CTP synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TTY6 0 971 87 0 541 3 pyrG CTP synthase Salmonella schwarzengrund (strain CVM19633)
Q6D181 0 971 87 0 545 3 pyrG CTP synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DDJ6 0 970 87 0 545 3 pyrG CTP synthase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5XV18 0 970 87 0 541 3 pyrG CTP synthase Klebsiella pneumoniae (strain 342)
A7MQY9 0 969 87 0 541 3 pyrG CTP synthase Cronobacter sakazakii (strain ATCC BAA-894)
P65921 0 969 87 0 541 3 pyrG CTP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65922 0 969 87 0 541 3 pyrG CTP synthase Salmonella typhi
C0PXD6 0 969 87 0 541 3 pyrG CTP synthase Salmonella paratyphi C (strain RKS4594)
A9N2F5 0 969 87 0 541 3 pyrG CTP synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TFZ2 0 969 87 0 541 3 pyrG CTP synthase Salmonella heidelberg (strain SL476)
B5RDS6 0 969 87 0 541 3 pyrG CTP synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW41 0 969 87 0 541 3 pyrG CTP synthase Salmonella enteritidis PT4 (strain P125109)
B5FTV0 0 969 87 0 541 3 pyrG CTP synthase Salmonella dublin (strain CT_02021853)
Q57KG9 0 969 87 0 541 3 pyrG CTP synthase Salmonella choleraesuis (strain SC-B67)
Q7N836 0 969 89 0 545 3 pyrG CTP synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B5BF03 0 968 87 0 541 3 pyrG CTP synthase Salmonella paratyphi A (strain AKU_12601)
Q5PEJ0 0 968 87 0 541 3 pyrG CTP synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5F4P0 0 968 87 0 541 3 pyrG CTP synthase Salmonella agona (strain SL483)
B4T484 0 967 86 0 541 3 pyrG CTP synthase Salmonella newport (strain SL254)
Q3YY76 0 967 87 0 541 3 pyrG CTP synthase Shigella sonnei (strain Ss046)
P0A7E8 0 967 87 0 541 3 pyrG CTP synthase Shigella flexneri
Q0T1P8 0 967 87 0 541 3 pyrG CTP synthase Shigella flexneri serotype 5b (strain 8401)
Q32CD5 0 967 87 0 541 3 pyrG CTP synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q31XL0 0 967 87 0 541 3 pyrG CTP synthase Shigella boydii serotype 4 (strain Sb227)
B2TZF3 0 967 87 0 541 3 pyrG CTP synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LWP4 0 967 87 0 541 3 pyrG CTP synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R7R3 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli (strain UTI89 / UPEC)
B1LQB3 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli (strain SMS-3-5 / SECEC)
B6I6H6 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli (strain SE11)
B7N716 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A7E5 0 967 87 0 541 1 pyrG CTP synthase Escherichia coli (strain K12)
B1IU61 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A7E6 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TE79 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEW8 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O1:K1 / APEC
A8A3R5 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O9:H4 (strain HS)
B1XDJ0 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli (strain K12 / DH10B)
C4ZZT3 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXJ6 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O8 (strain IAI1)
B7MZ76 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O81 (strain ED1a)
B7NV70 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3E4 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A7E7 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O157:H7
B7LEK0 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli (strain 55989 / EAEC)
B7MLA1 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZQM3 0 967 87 0 541 3 pyrG CTP synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UHJ6 0 964 87 0 541 3 pyrG CTP synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A4WDW8 0 964 86 0 541 3 pyrG CTP synthase Enterobacter sp. (strain 638)
A8ANY8 0 962 86 0 541 3 pyrG CTP synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C5B8X3 0 952 85 0 545 3 pyrG CTP synthase Edwardsiella ictaluri (strain 93-146)
Q2NVN8 0 940 85 0 541 3 pyrG CTP synthase Sodalis glossinidius (strain morsitans)
B8F5Q9 0 929 80 0 540 3 pyrG CTP synthase Glaesserella parasuis serovar 5 (strain SH0165)
B0BS41 0 926 80 0 540 3 pyrG CTP synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZX8 0 926 80 0 540 3 pyrG CTP synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q7MHQ0 0 923 81 0 545 3 pyrG CTP synthase Vibrio vulnificus (strain YJ016)
Q8DC63 0 923 81 0 545 3 pyrG CTP synthase Vibrio vulnificus (strain CMCP6)
A3MYK8 0 921 80 0 540 3 pyrG CTP synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
P44341 0 916 81 0 545 3 pyrG CTP synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UIK2 0 916 81 0 545 3 pyrG CTP synthase Haemophilus influenzae (strain PittGG)
A5UD28 0 914 81 0 545 3 pyrG CTP synthase Haemophilus influenzae (strain PittEE)
Q4QLL2 0 914 81 0 545 3 pyrG CTP synthase Haemophilus influenzae (strain 86-028NP)
C4LBR2 0 911 80 0 541 3 pyrG CTP synthase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
C3LQZ1 0 910 81 0 545 3 pyrG CTP synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KPC4 0 910 81 0 545 3 pyrG CTP synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5I4 0 910 81 0 545 3 pyrG CTP synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7VNV5 0 908 79 0 540 3 pyrG CTP synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q87LP9 0 906 80 0 542 3 pyrG CTP synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MTS6 0 905 81 0 542 3 pyrG CTP synthase Vibrio campbellii (strain ATCC BAA-1116)
Q9CJW9 0 904 80 0 541 3 pyrG CTP synthase Pasteurella multocida (strain Pm70)
Q0I200 0 904 80 0 541 3 pyrG CTP synthase Histophilus somni (strain 129Pt)
Q5E325 0 902 79 0 545 3 pyrG CTP synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LMT0 0 902 80 0 545 3 pyrG CTP synthase Photobacterium profundum (strain SS9)
Q1LTN7 0 901 79 1 544 3 pyrG CTP synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
B6EKL9 0 901 79 0 542 3 pyrG CTP synthase Aliivibrio salmonicida (strain LFI1238)
A6VR01 0 899 80 0 541 3 pyrG CTP synthase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B5FAG0 0 898 79 0 545 3 pyrG CTP synthase Aliivibrio fischeri (strain MJ11)
A0KGH2 0 898 80 0 545 3 pyrG CTP synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B7VK69 0 897 80 0 545 3 pyrG CTP synthase Vibrio atlanticus (strain LGP32)
Q65VZ8 0 895 80 0 541 3 pyrG CTP synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A4SRC2 0 890 79 0 545 3 pyrG CTP synthase Aeromonas salmonicida (strain A449)
Q12PZ5 0 854 77 0 544 3 pyrG CTP synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1S4D6 0 854 77 0 541 3 pyrG CTP synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A1SSQ6 0 853 75 0 542 3 pyrG CTP synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1RHF2 0 850 77 0 545 3 pyrG CTP synthase Shewanella sp. (strain W3-18-1)
Q0HL73 0 850 77 0 545 3 pyrG CTP synthase Shewanella sp. (strain MR-4)
A0KU81 0 850 77 0 545 3 pyrG CTP synthase Shewanella sp. (strain ANA-3)
A4Y944 0 850 77 0 545 3 pyrG CTP synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0HXH1 0 849 77 0 545 3 pyrG CTP synthase Shewanella sp. (strain MR-7)
Q8EBQ9 0 849 77 0 545 3 pyrG CTP synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9KYH1 0 848 76 0 545 3 pyrG CTP synthase Shewanella baltica (strain OS195)
A6WR29 0 848 76 0 545 3 pyrG CTP synthase Shewanella baltica (strain OS185)
A3D796 0 848 76 0 545 3 pyrG CTP synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E8T0 0 847 76 0 545 3 pyrG CTP synthase Shewanella baltica (strain OS223)
C4K4K0 0 847 75 0 545 3 pyrG CTP synthase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A8FSS7 0 845 76 0 541 3 pyrG CTP synthase Shewanella sediminis (strain HAW-EB3)
Q086B1 0 845 76 0 541 3 pyrG CTP synthase Shewanella frigidimarina (strain NCIMB 400)
A3QC76 0 844 76 0 541 3 pyrG CTP synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B0TK03 0 841 76 0 541 3 pyrG CTP synthase Shewanella halifaxensis (strain HAW-EB4)
A8H1S4 0 840 76 0 541 3 pyrG CTP synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B1KPT7 0 838 76 0 541 3 pyrG CTP synthase Shewanella woodyi (strain ATCC 51908 / MS32)
B4RVU4 0 832 75 0 539 3 pyrG CTP synthase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q493N6 0 832 72 1 541 3 pyrG CTP synthase Blochmanniella pennsylvanica (strain BPEN)
Q15QR7 0 829 74 0 539 3 pyrG CTP synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5R142 0 823 72 0 541 3 pyrG CTP synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q47WQ9 0 815 72 0 541 3 pyrG CTP synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3IDM3 0 812 75 0 542 3 pyrG CTP synthase Pseudoalteromonas translucida (strain TAC 125)
Q1I644 0 805 71 0 534 3 pyrG CTP synthase Pseudomonas entomophila (strain L48)
B0KSB7 0 805 71 0 534 3 pyrG CTP synthase Pseudomonas putida (strain GB-1)
A4XWS3 0 803 71 0 534 3 pyrG CTP synthase Pseudomonas mendocina (strain ymp)
Q88MG1 0 803 71 0 534 3 pyrG CTP synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W831 0 803 71 0 534 3 pyrG CTP synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1JBP2 0 800 70 0 534 3 pyrG CTP synthase Pseudomonas putida (strain W619)
Q3KH94 0 799 70 1 540 3 pyrG CTP synthase Pseudomonas fluorescens (strain Pf0-1)
P57491 0 799 68 1 545 3 pyrG CTP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A4VJT9 0 798 71 0 534 3 pyrG CTP synthase Stutzerimonas stutzeri (strain A1501)
B8D9J4 0 797 67 1 545 3 pyrG CTP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
C3K6H4 0 796 70 1 540 3 pyrG CTP synthase Pseudomonas fluorescens (strain SBW25)
Q9HXZ4 0 796 70 0 534 3 pyrG CTP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RA9 0 796 70 0 534 3 pyrG CTP synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V7V1 0 796 70 0 534 3 pyrG CTP synthase Pseudomonas aeruginosa (strain LESB58)
A6V1F1 0 796 70 0 534 3 pyrG CTP synthase Pseudomonas aeruginosa (strain PA7)
B8D7U6 0 796 67 1 545 3 pyrG CTP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
C1DSS8 0 795 71 0 534 3 pyrG CTP synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q4KHF8 0 794 70 1 540 3 pyrG CTP synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4ZWR0 0 790 70 1 540 3 pyrG CTP synthase Pseudomonas syringae pv. syringae (strain B728a)
Q886M5 0 789 70 1 540 3 pyrG CTP synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48F77 0 788 70 1 540 3 pyrG CTP synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2SKX2 0 786 70 0 540 3 pyrG CTP synthase Hahella chejuensis (strain KCTC 2396)
A1TZ46 0 783 69 0 540 3 pyrG CTP synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P59039 0 779 68 1 535 3 pyrG CTP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1QZX9 0 774 69 0 531 3 pyrG CTP synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B8GQ73 0 769 68 0 534 3 pyrG CTP synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q7VQH4 0 769 66 2 544 3 pyrG CTP synthase Blochmanniella floridana
Q0A7K2 0 768 67 0 534 3 pyrG CTP synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q21LC4 0 766 66 0 539 3 pyrG CTP synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q604M6 0 764 67 0 540 3 pyrG CTP synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B6J4W8 0 763 65 1 545 3 pyrG CTP synthase Coxiella burnetii (strain CbuK_Q154)
A9N9V5 0 762 65 1 545 3 pyrG CTP synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KDH0 0 762 65 1 545 3 pyrG CTP synthase Coxiella burnetii (strain Dugway 5J108-111)
Q83B36 0 761 65 1 545 3 pyrG CTP synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
B6J3W7 0 761 65 1 545 3 pyrG CTP synthase Coxiella burnetii (strain CbuG_Q212)
Q8D2K0 0 758 64 1 540 3 pyrG CTP synthase Wigglesworthia glossinidia brevipalpis
Q47DH9 0 749 65 1 542 3 pyrG CTP synthase Dechloromonas aromatica (strain RCB)
P59577 0 746 64 1 541 3 pyrG CTP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q31G66 0 742 64 0 539 3 pyrG CTP synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1K7F8 0 738 65 1 536 3 pyrG CTP synthase Azoarcus sp. (strain BH72)
Q5NZ71 0 737 65 0 531 3 pyrG CTP synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1KUX8 0 736 65 2 543 3 pyrG CTP synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JTK1 0 736 65 2 543 3 pyrG CTP synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M0Y3 0 736 65 2 543 3 pyrG CTP synthase Neisseria meningitidis serogroup C (strain 053442)
C1DCC1 0 736 67 1 535 3 pyrG CTP synthase Laribacter hongkongensis (strain HLHK9)
B4RJ40 0 736 65 2 543 3 pyrG CTP synthase Neisseria gonorrhoeae (strain NCCP11945)
Q5F7G6 0 736 65 2 543 3 pyrG CTP synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JYJ8 0 735 65 2 543 3 pyrG CTP synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B0RUK3 0 735 64 3 549 3 pyrG CTP synthase Xanthomonas campestris pv. campestris (strain B100)
Q8P9Z6 0 734 64 3 549 3 pyrG CTP synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTN9 0 734 64 3 549 3 pyrG CTP synthase Xanthomonas campestris pv. campestris (strain 8004)
Q7NSG9 0 732 65 1 539 3 pyrG CTP synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A1WWZ4 0 731 63 0 540 3 pyrG CTP synthase Halorhodospira halophila (strain DSM 244 / SL1)
Q9PDU1 0 731 65 2 544 3 pyrG CTP synthase Xylella fastidiosa (strain 9a5c)
Q87DY8 0 731 65 2 544 3 pyrG CTP synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I935 0 731 65 2 544 3 pyrG CTP synthase Xylella fastidiosa (strain M23)
Q5GYK0 0 730 64 3 549 3 pyrG CTP synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUA3 0 730 64 3 549 3 pyrG CTP synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P1K5 0 730 64 3 549 3 pyrG CTP synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2I2A7 0 730 63 2 541 3 pyrG CTP synthase Acinetobacter baumannii (strain ACICU)
B0V675 0 729 63 2 541 3 pyrG CTP synthase Acinetobacter baumannii (strain AYE)
A3M5Y3 0 729 63 2 541 3 pyrG CTP synthase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VQI6 0 729 63 2 541 3 pyrG CTP synthase Acinetobacter baumannii (strain SDF)
B7I920 0 729 63 2 541 3 pyrG CTP synthase Acinetobacter baumannii (strain AB0057)
B7H225 0 729 63 2 541 3 pyrG CTP synthase Acinetobacter baumannii (strain AB307-0294)
B0U656 0 729 65 2 544 3 pyrG CTP synthase Xylella fastidiosa (strain M12)
Q3SL45 0 728 64 1 541 3 pyrG CTP synthase Thiobacillus denitrificans (strain ATCC 25259)
Q3BUT3 0 727 63 3 549 3 pyrG CTP synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PLS3 0 727 63 3 549 3 pyrG CTP synthase Xanthomonas axonopodis pv. citri (strain 306)
Q0VQD8 0 727 64 0 539 3 pyrG CTP synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A1TLT0 0 725 63 4 547 3 pyrG CTP synthase Paracidovorax citrulli (strain AAC00-1)
Q6FAT7 0 724 63 2 536 3 pyrG CTP synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4FR69 0 722 63 3 539 3 pyrG CTP synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1Q9K1 0 721 63 3 539 3 pyrG CTP synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1H009 0 721 62 2 542 3 pyrG CTP synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A5WG19 0 719 63 3 541 3 pyrG CTP synthase Psychrobacter sp. (strain PRwf-1)
Q2KZF8 0 718 64 2 543 3 pyrG CTP synthase Bordetella avium (strain 197N)
Q5WXA8 0 716 64 0 534 3 pyrG CTP synthase Legionella pneumophila (strain Lens)
Q5ZWA4 0 716 64 0 534 3 pyrG CTP synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IB79 0 716 64 0 534 3 pyrG CTP synthase Legionella pneumophila (strain Corby)
Q5X5Y6 0 716 64 0 534 3 pyrG CTP synthase Legionella pneumophila (strain Paris)
A4SXE7 0 715 63 3 550 3 pyrG CTP synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q7VW76 0 715 64 2 543 3 pyrG CTP synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W5N6 0 715 64 2 543 3 pyrG CTP synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD72 0 715 64 2 543 3 pyrG CTP synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2Y9P1 0 714 65 1 537 3 pyrG CTP synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
C5CSV3 0 712 62 4 545 3 pyrG CTP synthase Variovorax paradoxus (strain S110)
A1W4R3 0 712 61 4 551 3 pyrG CTP synthase Acidovorax sp. (strain JS42)
B9MEQ7 0 712 61 4 551 3 pyrG CTP synthase Acidovorax ebreus (strain TPSY)
A6SXG2 0 711 64 2 536 3 pyrG CTP synthase Janthinobacterium sp. (strain Marseille)
A9AGW0 0 711 64 3 547 3 pyrG CTP synthase Burkholderia multivorans (strain ATCC 17616 / 249)
A9IIP5 0 711 63 2 543 3 pyrG CTP synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A9BN39 0 711 61 4 551 3 pyrG CTP synthase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q0AD92 0 710 64 1 536 3 pyrG CTP synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B2JIX2 0 709 64 3 541 3 pyrG CTP synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q21V39 0 709 61 3 545 3 pyrG CTP synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q3JCT3 0 709 63 0 539 3 pyrG CTP synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B1JUY8 0 708 63 3 547 3 pyrG CTP synthase Burkholderia orbicola (strain MC0-3)
B4EDA3 0 708 63 3 547 3 pyrG CTP synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q1BHS2 0 707 63 3 547 3 pyrG CTP synthase Burkholderia orbicola (strain AU 1054)
A0K8N3 0 707 63 3 547 3 pyrG CTP synthase Burkholderia cenocepacia (strain HI2424)
B2FK84 0 706 64 2 544 3 pyrG CTP synthase Stenotrophomonas maltophilia (strain K279a)
Q13X05 0 706 63 3 546 3 pyrG CTP synthase Paraburkholderia xenovorans (strain LB400)
O85347 0 706 63 1 536 3 pyrG CTP synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B2SXV1 0 705 64 3 541 3 pyrG CTP synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A4G738 0 705 63 2 539 3 pyrG CTP synthase Herminiimonas arsenicoxydans
Q1LPI8 0 705 62 3 546 3 pyrG CTP synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q39EV7 0 705 63 3 547 3 pyrG CTP synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1YT11 0 705 63 3 547 3 pyrG CTP synthase Burkholderia ambifaria (strain MC40-6)
B1XUS0 0 705 63 3 545 3 pyrG CTP synthase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A4JFY7 0 705 63 3 547 3 pyrG CTP synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0BDS1 0 704 63 3 547 3 pyrG CTP synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4SR82 0 704 64 2 544 3 pyrG CTP synthase Stenotrophomonas maltophilia (strain R551-3)
Q8Y0B8 0 704 62 3 541 3 pyrG CTP synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B3R496 0 703 63 3 546 3 pyrG CTP synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A5EW22 0 702 60 0 538 3 pyrG CTP synthase Dichelobacter nodosus (strain VCS1703A)
Q0KCE5 0 701 62 3 546 3 pyrG CTP synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B2SFK1 0 698 62 2 539 3 pyrG CTP synthase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q473G7 0 698 62 3 546 3 pyrG CTP synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A4IZP3 0 697 62 2 539 3 pyrG CTP synthase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NHS1 0 697 62 2 539 3 pyrG CTP synthase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q4L3 0 697 62 2 539 3 pyrG CTP synthase Francisella tularensis subsp. novicida (strain U112)
Q14J73 0 697 62 2 539 3 pyrG CTP synthase Francisella tularensis subsp. tularensis (strain FSC 198)
Q63SP8 0 697 63 3 546 3 pyrG CTP synthase Burkholderia pseudomallei (strain K96243)
Q3JQQ4 0 697 63 3 546 3 pyrG CTP synthase Burkholderia pseudomallei (strain 1710b)
A1V5K4 0 697 63 3 546 3 pyrG CTP synthase Burkholderia mallei (strain SAVP1)
Q62J08 0 697 63 3 546 3 pyrG CTP synthase Burkholderia mallei (strain ATCC 23344)
A3ML79 0 697 63 3 546 3 pyrG CTP synthase Burkholderia mallei (strain NCTC 10247)
B2U9C0 0 696 62 3 546 3 pyrG CTP synthase Ralstonia pickettii (strain 12J)
Q2SXC7 0 696 63 3 547 3 pyrG CTP synthase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q128E7 0 695 60 3 545 3 pyrG CTP synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q0BLA3 0 695 62 2 539 3 pyrG CTP synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A2S0 0 695 62 2 539 3 pyrG CTP synthase Francisella tularensis subsp. holarctica (strain LVS)
A7ND08 0 695 62 2 539 3 pyrG CTP synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A2SAU5 0 695 63 3 546 3 pyrG CTP synthase Burkholderia mallei (strain NCTC 10229)
B0U0L7 0 694 62 2 536 3 pyrG CTP synthase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A1WL89 0 694 61 5 542 3 pyrG CTP synthase Verminephrobacter eiseniae (strain EF01-2)
A1VLH3 0 692 60 3 548 3 pyrG CTP synthase Polaromonas naphthalenivorans (strain CJ2)
B1Y4K6 0 664 59 3 548 3 pyrG CTP synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B5EPM5 0 656 63 0 534 3 pyrG CTP synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J6R2 0 656 63 0 534 3 pyrG CTP synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q24MK9 0 648 57 4 541 3 pyrG CTP synthase Desulfitobacterium hafniense (strain Y51)
C1F1E7 0 647 57 2 542 3 pyrG CTP synthase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q97F61 0 644 58 3 539 3 pyrG CTP synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P13242 0 644 57 4 544 1 pyrG CTP synthase Bacillus subtilis (strain 168)
Q3A371 0 643 56 2 537 3 pyrG CTP synthase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2LRK2 0 640 57 2 537 3 pyrG CTP synthase Syntrophus aciditrophicus (strain SB)
Q9K6D7 0 640 56 3 539 3 pyrG CTP synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B8I598 0 639 57 4 541 3 pyrG CTP synthase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
C6BWN7 0 639 57 3 543 3 pyrG CTP synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q65DT7 0 639 58 4 537 3 pyrG CTP synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q310T4 0 638 57 3 539 3 pyrG CTP synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q0AU97 0 637 56 4 542 3 pyrG CTP synthase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q8R720 0 637 57 3 534 3 pyrG CTP synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A1VDL2 0 636 56 3 545 3 pyrG CTP synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q72BL2 0 636 56 3 545 3 pyrG CTP synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q5KUG2 0 636 57 3 537 3 pyrG CTP synthase Geobacillus kaustophilus (strain HTA426)
Q1DDB7 0 635 56 3 537 3 pyrG CTP synthase Myxococcus xanthus (strain DK1622)
A7HIF0 0 635 58 2 540 3 pyrG CTP synthase Anaeromyxobacter sp. (strain Fw109-5)
B8DJR8 0 635 56 3 545 3 pyrG CTP synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q1MR71 0 634 55 3 549 3 pyrG CTP synthase Lawsonia intracellularis (strain PHE/MN1-00)
Q74BY3 0 634 57 3 542 3 pyrG CTP synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8EM53 0 634 56 4 544 3 pyrG CTP synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3AFT7 0 634 58 3 542 3 pyrG CTP synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B8JBN6 0 632 58 4 540 3 pyrG CTP synthase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A8FIE5 0 632 56 3 537 3 pyrG CTP synthase Bacillus pumilus (strain SAFR-032)
Q5WB43 0 632 56 3 539 3 pyrG CTP synthase Shouchella clausii (strain KSM-K16)
Q6AQ78 0 631 55 2 543 3 pyrG CTP synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B8IZF5 0 631 57 3 546 3 pyrG CTP synthase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q2IH81 0 631 58 4 540 3 pyrG CTP synthase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q2RFU8 0 630 56 2 544 3 pyrG CTP synthase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A7Z9T4 0 630 56 3 537 3 pyrG CTP synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q39W62 0 630 56 3 542 3 pyrG CTP synthase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q3MAV1 0 630 56 3 537 3 pyrG CTP synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YMD4 0 630 56 3 537 3 pyrG CTP synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A5N3K4 0 630 55 3 543 3 pyrG CTP synthase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q0C195 0 629 56 6 542 3 pyrG CTP synthase Hyphomonas neptunium (strain ATCC 15444)
B4UIT6 0 628 58 4 540 3 pyrG CTP synthase Anaeromyxobacter sp. (strain K)
Q2W6A0 0 627 58 4 536 3 pyrG CTP synthase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A3DGR3 0 627 56 4 539 3 pyrG CTP synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q81JW1 0 625 55 3 542 3 pyrG CTP synthase Bacillus anthracis
C3LFL2 0 625 55 3 542 3 pyrG CTP synthase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P2A0 0 625 55 3 542 3 pyrG CTP synthase Bacillus anthracis (strain A0248)
B8EJS8 0 625 57 5 542 3 pyrG CTP synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q630R0 0 624 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain ZK / E33L)
B7JHG1 0 624 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain AH820)
B9IRX1 0 624 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain Q1)
B7HY98 0 624 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain AH187)
Q6HAU5 0 624 55 3 542 3 pyrG CTP synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1F0R6 0 624 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain 03BB102)
Q72XB0 0 624 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RLC3 0 624 55 3 542 3 pyrG CTP synthase Bacillus thuringiensis (strain Al Hakam)
A7GV88 0 623 55 3 542 3 pyrG CTP synthase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q1IKC9 0 622 55 3 545 3 pyrG CTP synthase Koribacter versatilis (strain Ellin345)
A5FXW7 0 622 59 6 543 3 pyrG CTP synthase Acidiphilium cryptum (strain JF-5)
B7IQZ1 0 622 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain G9842)
Q814T2 0 622 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HFN6 0 622 55 3 542 3 pyrG CTP synthase Bacillus cereus (strain B4264)
A9VSD6 0 621 55 3 542 3 pyrG CTP synthase Bacillus mycoides (strain KBAB4)
B7KUU9 0 620 58 5 542 3 pyrG CTP synthase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B0U802 0 619 58 5 537 3 pyrG CTP synthase Methylobacterium sp. (strain 4-46)
O67353 0 619 55 2 537 3 pyrG CTP synthase Aquifex aeolicus (strain VF5)
Q8CNI2 0 619 55 4 543 3 pyrG CTP synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM95 0 619 55 4 543 3 pyrG CTP synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2G6R7 0 619 57 3 537 3 pyrG CTP synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B1M5Q9 0 619 58 5 542 3 pyrG CTP synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q0SQX5 0 618 55 3 541 3 pyrG CTP synthase Clostridium perfringens (strain SM101 / Type A)
Q8XIB3 0 618 55 3 541 3 pyrG CTP synthase Clostridium perfringens (strain 13 / Type A)
Q0TNA4 0 618 55 3 541 3 pyrG CTP synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q11HU6 0 618 56 5 542 3 pyrG CTP synthase Chelativorans sp. (strain BNC1)
Q1QMJ4 0 616 57 5 535 3 pyrG CTP synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B8IP92 0 616 59 5 537 3 pyrG CTP synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q0BTX6 0 616 57 7 539 3 pyrG CTP synthase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B2IKQ2 0 616 56 5 542 3 pyrG CTP synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A5V8U1 0 616 58 5 538 3 pyrG CTP synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B1XMC5 0 616 55 3 539 3 pyrG CTP synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B1Z9R0 0 615 58 5 542 3 pyrG CTP synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A6LQF6 0 615 54 3 544 3 pyrG CTP synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q2RT58 0 615 58 5 537 3 pyrG CTP synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q1MGC4 0 615 57 5 540 3 pyrG CTP synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2FWD1 0 615 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
P65924 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain MW2)
A8YY92 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G7I3 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain MSSA476)
Q6GEU8 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain MRSA252)
P99072 0 614 54 4 543 1 pyrG CTP synthase Staphylococcus aureus (strain N315)
P65923 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIX1 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain Newman)
Q5HE73 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain COL)
Q2YUM6 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUS2 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain JH9)
Q2FF01 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain USA300)
A6U3L2 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain JH1)
A7X4X7 0 614 54 4 543 3 pyrG CTP synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
B3Q6M4 0 614 58 6 536 3 pyrG CTP synthase Rhodopseudomonas palustris (strain TIE-1)
Q6N5T4 0 614 58 6 536 3 pyrG CTP synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B9M9Q5 0 614 56 3 544 3 pyrG CTP synthase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q89KU5 0 614 58 7 538 3 pyrG CTP synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1GTY6 0 613 57 4 535 3 pyrG CTP synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q5N040 0 613 54 3 537 3 pyrG CTP synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B5ZPZ7 0 612 57 5 540 3 pyrG CTP synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B6IQ27 0 612 57 5 542 3 pyrG CTP synthase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q2K871 0 611 57 5 540 3 pyrG CTP synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3Q0M2 0 611 57 5 540 3 pyrG CTP synthase Rhizobium etli (strain CIAT 652)
Q54775 0 610 54 3 537 3 pyrG CTP synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P74208 0 610 53 3 536 3 pyrG CTP synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q67TG8 0 610 54 5 548 3 pyrG CTP synthase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A6X0L6 0 610 57 5 540 3 pyrG CTP synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8UEY5 0 610 56 5 540 3 pyrG CTP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7UJ86 0 610 56 6 543 3 pyrG CTP synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B9DME0 0 609 55 4 539 3 pyrG CTP synthase Staphylococcus carnosus (strain TM300)
Q92QA0 0 609 57 5 540 3 pyrG CTP synthase Rhizobium meliloti (strain 1021)
Q2NAA7 0 609 57 6 539 3 pyrG CTP synthase Erythrobacter litoralis (strain HTCC2594)
A7HXX9 0 609 56 4 541 3 pyrG CTP synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A6U8E2 0 608 57 5 540 3 pyrG CTP synthase Sinorhizobium medicae (strain WSM419)
Q168S7 0 608 57 5 546 3 pyrG CTP synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q07NF1 0 608 58 6 536 3 pyrG CTP synthase Rhodopseudomonas palustris (strain BisA53)
Q38V48 0 608 56 4 538 3 pyrG CTP synthase Latilactobacillus sakei subsp. sakei (strain 23K)
A9B6S7 0 607 55 3 537 3 pyrG CTP synthase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A5G5T3 0 607 55 3 544 3 pyrG CTP synthase Geotalea uraniireducens (strain Rf4)
A5EK18 0 607 57 7 537 3 pyrG CTP synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q2JUH1 0 607 55 3 537 3 pyrG CTP synthase Synechococcus sp. (strain JA-3-3Ab)
A2C5F9 0 607 54 3 535 3 pyrG CTP synthase Prochlorococcus marinus (strain NATL1A)
Q8YHF2 0 607 57 5 542 3 pyrG CTP synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
B7JVR6 0 606 54 3 545 3 pyrG CTP synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q3SRJ8 0 606 57 7 539 3 pyrG CTP synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A4YVC9 0 606 57 7 537 3 pyrG CTP synthase Bradyrhizobium sp. (strain ORS 278)
Q136D7 0 606 57 6 538 3 pyrG CTP synthase Rhodopseudomonas palustris (strain BisB5)
Q2IWB8 0 606 57 6 536 3 pyrG CTP synthase Rhodopseudomonas palustris (strain HaA2)
Q46I97 0 606 54 3 535 3 pyrG CTP synthase Prochlorococcus marinus (strain NATL2A)
Q0APT7 0 606 56 5 535 3 pyrG CTP synthase Maricaulis maris (strain MCS10)
A9HJ81 0 606 57 5 538 3 pyrG CTP synthase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A5UXX5 0 605 56 4 539 3 pyrG CTP synthase Roseiflexus sp. (strain RS-1)
Q49Z73 0 605 54 4 543 3 pyrG CTP synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5FNN2 0 605 57 4 537 3 pyrG CTP synthase Gluconobacter oxydans (strain 621H)
Q4L808 0 604 54 4 542 3 pyrG CTP synthase Staphylococcus haemolyticus (strain JCSC1435)
Q4FM39 0 604 54 4 538 3 pyrG CTP synthase Pelagibacter ubique (strain HTCC1062)
B0CGT4 0 604 57 5 542 3 pyrG CTP synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q73HS5 0 603 53 3 540 3 pyrG CTP synthase Wolbachia pipientis wMel
Q927T4 0 603 52 3 541 3 pyrG CTP synthase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A5VQQ9 0 603 57 5 542 3 pyrG CTP synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C0RJA5 0 603 57 5 542 3 pyrG CTP synthase Brucella melitensis biotype 2 (strain ATCC 23457)
B7KF08 0 603 53 3 539 3 pyrG CTP synthase Gloeothece citriformis (strain PCC 7424)
Q8G0G1 0 603 57 5 542 3 pyrG CTP synthase Brucella suis biovar 1 (strain 1330)
A9M5E7 0 603 57 5 542 3 pyrG CTP synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8DKT7 0 603 55 3 540 3 pyrG CTP synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q71WM0 0 603 52 3 541 3 pyrG CTP synthase Listeria monocytogenes serotype 4b (strain F2365)
B4U6A9 0 603 53 2 534 3 pyrG CTP synthase Hydrogenobaculum sp. (strain Y04AAS1)
Q57D05 0 602 56 5 542 3 pyrG CTP synthase Brucella abortus biovar 1 (strain 9-941)
Q2YPU8 0 602 56 5 542 3 pyrG CTP synthase Brucella abortus (strain 2308)
Q6A7X4 0 602 55 4 536 3 pyrG CTP synthase Cutibacterium acnes (strain DSM 16379 / KPA171202)
B0CBC7 0 602 54 5 542 3 pyrG CTP synthase Acaryochloris marina (strain MBIC 11017)
Q7V9I0 0 601 55 3 535 3 pyrG CTP synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A0M3I8 0 601 53 5 541 3 pyrG CTP synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B2S5Y5 0 601 56 5 542 3 pyrG CTP synthase Brucella abortus (strain S19)
Q5NQB9 0 600 57 4 536 3 pyrG CTP synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q215B2 0 600 57 7 537 3 pyrG CTP synthase Rhodopseudomonas palustris (strain BisB18)
Q98MF0 0 600 56 5 540 3 pyrG CTP synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8Y495 0 598 52 3 541 3 pyrG CTP synthase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q1WV30 0 598 55 4 539 3 pyrG CTP synthase Ligilactobacillus salivarius (strain UCC118)
Q939R0 0 598 54 6 545 3 pyrG CTP synthase Fibrobacter succinogenes (strain ATCC 19169 / S85)
C5A7F1 0 598 53 2 541 3 pyrG CTP synthase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
B3EAK5 0 597 55 3 538 3 pyrG CTP synthase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q836G5 0 597 54 6 543 3 pyrG CTP synthase Enterococcus faecalis (strain ATCC 700802 / V583)
A2BTS1 0 597 54 3 539 3 pyrG CTP synthase Prochlorococcus marinus (strain AS9601)
A7NN90 0 596 56 4 541 3 pyrG CTP synthase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A1APF9 0 596 56 3 538 3 pyrG CTP synthase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q58574 0 596 55 2 539 3 pyrG CTP synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A5GPM2 0 596 53 3 537 3 pyrG CTP synthase Synechococcus sp. (strain WH7803)
Q5JGF1 0 595 53 2 541 3 pyrG CTP synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B1WV74 0 595 53 3 542 3 pyrG CTP synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q7V3W8 0 594 53 3 537 3 pyrG CTP synthase Prochlorococcus marinus (strain MIT 9313)
Q317V2 0 594 53 3 540 3 pyrG CTP synthase Prochlorococcus marinus (strain MIT 9312)
A3PFH8 0 594 53 3 539 3 pyrG CTP synthase Prochlorococcus marinus (strain MIT 9301)
B2A3K5 0 594 56 4 541 3 pyrG CTP synthase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B0JU82 0 594 54 3 537 3 pyrG CTP synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P28595 0 594 56 7 545 3 pyrG CTP synthase Azospirillum brasilense
A9IS43 0 594 55 4 539 3 pyrG CTP synthase Bartonella tribocorum (strain CIP 105476 / IBS 506)
A2CDX8 0 593 53 3 537 3 pyrG CTP synthase Prochlorococcus marinus (strain MIT 9303)
Q6LYU4 0 593 54 3 539 3 pyrG CTP synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q5LTV0 0 593 55 5 546 3 pyrG CTP synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q3AGF7 0 593 54 3 537 3 pyrG CTP synthase Synechococcus sp. (strain CC9605)
A8G7J4 0 592 53 3 539 3 pyrG CTP synthase Prochlorococcus marinus (strain MIT 9215)
Q4JVX2 0 592 53 6 552 3 pyrG CTP synthase Corynebacterium jeikeium (strain K411)
Q7NKF4 0 592 54 4 542 3 pyrG CTP synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q1GF61 0 592 55 5 546 3 pyrG CTP synthase Ruegeria sp. (strain TM1040)
Q8DQY0 0 591 53 4 543 3 pyrG CTP synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q47QN2 0 591 54 6 541 3 pyrG CTP synthase Thermobifida fusca (strain YX)
B8HNM9 0 591 55 4 547 3 pyrG CTP synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B0SYY1 0 591 55 6 550 3 pyrG CTP synthase Caulobacter sp. (strain K31)
A9BDD9 0 590 54 3 535 3 pyrG CTP synthase Prochlorococcus marinus (strain MIT 9211)
A1US92 0 590 55 4 539 3 pyrG CTP synthase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q110M9 0 590 52 4 556 3 pyrG CTP synthase Trichodesmium erythraeum (strain IMS101)
Q97S93 0 590 53 4 543 3 pyrG CTP synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A5CYA0 0 590 55 3 537 3 pyrG CTP synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q7U3K4 0 590 52 3 537 3 pyrG CTP synthase Parasynechococcus marenigrum (strain WH8102)
Q3YSZ0 0 589 50 2 542 3 pyrG CTP synthase Ehrlichia canis (strain Jake)
Q6MPP0 0 589 53 2 537 3 pyrG CTP synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B9L1H7 0 589 54 2 536 3 pyrG CTP synthase Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
B9LB79 0 588 55 4 540 3 pyrG CTP synthase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WJ75 0 588 55 4 540 3 pyrG CTP synthase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q1J4X1 0 588 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q8NZF8 0 588 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q2J878 0 588 52 5 550 3 pyrG CTP synthase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q3AUG4 0 588 53 3 536 3 pyrG CTP synthase Synechococcus sp. (strain CC9902)
A1SJK4 0 588 52 5 551 3 pyrG CTP synthase Nocardioides sp. (strain ATCC BAA-499 / JS614)
B6YTF0 0 587 52 2 541 3 pyrG CTP synthase Thermococcus onnurineus (strain NA1)
P0DD71 0 587 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1JK23 0 587 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1J9X6 0 587 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XA10 0 587 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DD70 0 587 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P65925 0 587 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M1
B8GAQ5 0 587 55 4 538 3 pyrG CTP synthase Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q88Z76 0 587 54 5 547 3 pyrG CTP synthase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A6H0U1 0 587 53 6 541 3 pyrG CTP synthase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A8LIN6 0 587 55 5 543 3 pyrG CTP synthase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A5GWT6 0 587 53 3 538 3 pyrG CTP synthase Synechococcus sp. (strain RCC307)
A2BZ76 0 587 53 3 539 3 pyrG CTP synthase Prochlorococcus marinus (strain MIT 9515)
Q6G027 0 586 54 4 539 3 pyrG CTP synthase Bartonella quintana (strain Toulouse)
Q0I677 0 585 52 3 537 3 pyrG CTP synthase Synechococcus sp. (strain CC9311)
Q48RF1 0 585 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JF16 0 585 52 4 541 3 pyrG CTP synthase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q9V1S2 0 585 53 3 540 3 pyrG CTP synthase Pyrococcus abyssi (strain GE5 / Orsay)
Q2JLG7 0 585 56 3 537 3 pyrG CTP synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q73J84 0 585 50 3 544 3 pyrG CTP synthase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8DWG1 0 584 52 4 544 3 pyrG CTP synthase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A4FKA9 0 584 53 4 543 3 pyrG CTP synthase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B2IUT0 0 583 55 4 537 3 pyrG CTP synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A1B8D4 0 583 55 5 546 3 pyrG CTP synthase Paracoccus denitrificans (strain Pd 1222)
A8AZ08 0 582 52 4 540 3 pyrG CTP synthase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8E290 0 582 51 4 543 3 pyrG CTP synthase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8F3J3 0 582 51 4 544 3 pyrG CTP synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72S46 0 582 51 4 544 3 pyrG CTP synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B8GW64 0 582 54 6 550 3 pyrG CTP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A7K3 0 582 54 6 550 3 pyrG CTP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A6UTE4 0 582 53 4 547 3 pyrG CTP synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q28MG4 0 582 55 5 544 3 pyrG CTP synthase Jannaschia sp. (strain CCS1)
Q1AW18 0 581 54 3 535 3 pyrG CTP synthase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12830
Feature type CDS
Gene pyrG
Product CTP synthase (glutamine hydrolyzing)
Location 167008 - 168645 (strand: -1)
Length 1638 (nucleotides) / 545 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1871
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00117 Glutamine amidotransferase class-I
PF06418 CTP synthase N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0504 Nucleotide transport and metabolism (F) F CTP synthase (UTP-ammonia lyase)

Kegg Ortholog Annotation(s)

Protein Sequence

MKTNYIFVTGGVVSSLGKGIAAASLAAILEARGLNVTMMKLDPYINVDPGTMSPTQHGEVFVTNDGAETDLDLGHYERFIRTKMTRGNNFTTGRVYSEVLRKERRGDYLGATIQVIPHITNEIKERIIRGGEGHDVVLVEIGGTVGDIESLPFLEAIRQMAAQVGREHTLYMHLTLVPYLAAAGEVKTKPTQHSVKELLSIGIQPDVLICRSDRVIPANERAKIALFCNVPEKAVISLKDVDSIYKIPGLLKSQGLDDYICKRFSINAPEADLSEWEQVIYEEANPSGEVTIGMVGKYVELPDAYKSVIEALKHGGLKNRVTVNIKLIDSQDVETRGVEVLQGLDAILVPGGFGSRGVEGKIMTARYARENKIPYLGICLGMQVALIDIARNLANMEGANSTEFDVDCKYPVIALITEWRDEEGNLEVRSEESDLGGTMRVGGQLCHLTNNTLVRQLYGKDAITERHRHRYEVNNMLLKRLEDAGLLVAGRSVDNKLVEIIENPNHPWFVACQFHPEFTSTPRDGHPLFAGFVKAASDNQKGLLK

Flanking regions ( +/- flanking 50bp)

CCCGTCCGGTTATCTCCATCATCTATTACACCTAAACTTTCAGGTTCAGCATGAAAACTAATTATATTTTTGTGACCGGCGGGGTCGTATCCTCTCTGGGTAAAGGCATTGCCGCAGCCTCTCTGGCAGCTATACTCGAAGCCCGTGGACTCAATGTCACCATGATGAAACTGGATCCGTACATCAACGTCGATCCGGGAACAATGAGCCCGACCCAGCACGGGGAAGTCTTCGTCACCAATGACGGCGCTGAAACTGACCTTGACTTAGGTCACTACGAGCGTTTCATCCGCACTAAAATGACCCGGGGTAATAACTTTACGACCGGGCGTGTTTACTCCGAAGTTTTGCGCAAAGAGCGCCGTGGCGACTACTTAGGTGCCACTATTCAGGTTATTCCTCACATCACCAATGAAATCAAAGAACGTATCATCCGTGGTGGTGAAGGTCATGATGTCGTGCTGGTGGAAATCGGCGGAACGGTGGGTGATATCGAATCACTGCCATTCCTGGAAGCTATCCGTCAGATGGCGGCACAAGTCGGCCGTGAGCATACGTTATACATGCATCTGACGTTAGTGCCGTATCTGGCCGCTGCCGGTGAAGTAAAAACCAAGCCGACCCAGCATTCTGTAAAAGAATTATTATCCATCGGAATTCAGCCTGATGTGCTGATTTGCCGTTCTGACAGAGTGATCCCTGCTAACGAAAGAGCAAAAATCGCCCTTTTCTGTAATGTTCCTGAAAAGGCCGTGATCAGTCTGAAAGACGTCGATTCCATTTATAAAATCCCCGGCCTCTTGAAATCCCAGGGATTAGATGATTATATCTGTAAACGATTCAGCATCAATGCACCTGAGGCAGATCTCTCCGAATGGGAGCAGGTGATTTACGAAGAAGCCAATCCGTCAGGTGAAGTGACCATCGGAATGGTCGGTAAATATGTTGAATTGCCGGATGCCTATAAATCTGTGATCGAAGCGCTGAAACACGGTGGACTGAAAAACCGTGTCACGGTTAACATCAAACTGATCGATTCTCAGGATGTTGAAACCCGTGGCGTTGAAGTATTACAGGGACTGGATGCAATCCTGGTACCAGGCGGGTTCGGTTCCCGTGGTGTGGAAGGCAAGATAATGACTGCCCGCTATGCCCGCGAGAACAAAATTCCGTATCTGGGCATTTGCTTAGGGATGCAGGTGGCGTTAATCGATATCGCCCGCAACCTGGCTAATATGGAAGGTGCAAACTCCACAGAGTTTGATGTGGATTGTAAATATCCGGTCATTGCGCTTATCACTGAATGGCGCGATGAAGAAGGTAATCTTGAAGTCCGCAGCGAAGAGAGTGATCTCGGTGGTACGATGCGTGTCGGCGGCCAGTTATGCCATCTGACGAACAATACACTGGTTCGTCAGTTGTATGGCAAAGATGCGATTACTGAACGTCACCGCCATCGCTATGAAGTGAACAACATGTTGCTGAAGCGTCTTGAAGATGCAGGTTTGCTGGTTGCAGGCCGTTCAGTTGATAATAAACTGGTGGAAATTATTGAGAACCCTAATCATCCGTGGTTTGTGGCTTGTCAGTTCCACCCGGAGTTCACATCAACCCCGCGTGATGGTCATCCGCTGTTTGCAGGTTTTGTCAAAGCGGCCTCTGATAACCAGAAAGGTCTGCTGAAATAAGATATGAGATAAGTGACCGGTGATAAGTGCCGGTTACTTATCAAAAATTT