Homologs in group_781

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03080 FBDBKF_03080 93.7 Morganella morganii S1 dolP division/outer membrane stress-associated lipid-binding lipoprotein
EHELCC_07455 EHELCC_07455 93.7 Morganella morganii S2 dolP division/outer membrane stress-associated lipid-binding lipoprotein
NLDBIP_07780 NLDBIP_07780 93.7 Morganella morganii S4 dolP division/outer membrane stress-associated lipid-binding lipoprotein
LHKJJB_07315 LHKJJB_07315 93.7 Morganella morganii S3 dolP division/outer membrane stress-associated lipid-binding lipoprotein
HKOGLL_03615 HKOGLL_03615 93.7 Morganella morganii S5 dolP division/outer membrane stress-associated lipid-binding lipoprotein
PMI_RS18355 PMI_RS18355 70.5 Proteus mirabilis HI4320 dolP division/outer membrane stress-associated lipid-binding lipoprotein

Distribution of the homologs in the orthogroup group_781

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_781

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7CPQ6 3.58e-76 229 67 2 186 2 dolP Outer membrane lipoprotein DolP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P64596 2.5e-74 224 66 2 186 1 dolP Outer membrane lipoprotein DolP Escherichia coli (strain K12)
P64597 2.5e-74 224 66 2 186 3 dolP Outer membrane lipoprotein DolP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P64598 2.5e-74 224 66 2 186 3 dolP Outer membrane lipoprotein DolP Escherichia coli O157:H7
P45301 2.17e-49 161 45 2 186 3 dolP Outer membrane lipoprotein DolP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P46028 6.06e-38 132 48 1 154 3 hly 21 kDa hemolysin Actinobacillus pleuropneumoniae
P0AFH8 8.27e-05 45 31 2 145 1 osmY Osmotically-inducible protein Y Escherichia coli (strain K12)
P0AFH9 8.27e-05 45 31 2 145 3 osmY Osmotically-inducible protein Y Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11840
Feature type CDS
Gene dolP
Product division/outer membrane stress-associated lipid-binding lipoprotein
Location 523633 - 524205 (strand: -1)
Length 573 (nucleotides) / 190 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_781
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04972 BON domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2823 Cell wall/membrane/envelope biogenesis (M) M Osmotically-inducible protein OsmY, contains BON domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04065 hyperosmotically inducible periplasmic protein - -

Protein Sequence

MRIVPVAALVCTALLLQGCIGAAIVGSAAVATKAATDPRSVGTQVDDGTLEARVSGQLNKDKDIKQARIVPVAYQGKVLLIGQADDLSLARRAKEIAAKVDGTEMVYNEVRQGAPVDLGTASKDAWITTKVRSKLLTSDAVKSANIKVLTENGEIFLLGVVTRQEGAAAAKIASETDGAKKVTTAFTWLN

Flanking regions ( +/- flanking 50bp)

ATTTAATCGACAATACCCTTTTCCCCCATCAGGAAGACTAAGGAGATATTATGAGAATCGTGCCCGTGGCAGCACTTGTCTGTACCGCATTACTGTTACAGGGATGTATCGGCGCAGCTATCGTCGGATCTGCGGCTGTTGCAACCAAGGCCGCCACAGACCCCCGCTCTGTCGGTACACAGGTCGATGACGGCACATTAGAAGCCCGTGTCAGTGGCCAGCTCAATAAAGATAAAGATATCAAACAGGCGCGTATTGTCCCTGTTGCCTATCAGGGAAAAGTCCTGCTGATTGGTCAGGCTGATGATTTGTCTCTGGCGCGGCGCGCAAAAGAAATTGCCGCTAAAGTTGACGGAACCGAAATGGTCTACAACGAAGTCCGTCAGGGAGCCCCTGTCGATTTGGGCACCGCATCAAAAGATGCATGGATAACCACCAAAGTCCGCTCCAAGTTACTGACCAGTGACGCGGTAAAATCGGCTAATATTAAAGTGCTGACTGAAAACGGAGAGATTTTTCTGTTAGGTGTGGTAACGCGTCAGGAAGGCGCTGCCGCGGCAAAAATTGCCAGTGAAACCGACGGCGCGAAGAAAGTCACCACCGCCTTTACCTGGCTCAATTAACCGGGACTTTCAGAAACAGATAAGAAACCTGACCCGCAGTCAGGTTTTTT