Homologs in group_1377

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08515 FBDBKF_08515 96.1 Morganella morganii S1 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
EHELCC_13010 EHELCC_13010 96.1 Morganella morganii S2 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
NLDBIP_13350 NLDBIP_13350 96.1 Morganella morganii S4 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
LHKJJB_13205 LHKJJB_13205 96.1 Morganella morganii S3 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
HKOGLL_11825 HKOGLL_11825 96.1 Morganella morganii S5 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
PMI_RS16845 PMI_RS16845 76.2 Proteus mirabilis HI4320 - peptidylprolyl isomerase

Distribution of the homologs in the orthogroup group_1377

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1377

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9L4 9.88e-119 338 79 0 206 3 fklB FKBP-type 22 kDa peptidyl-prolyl cis-trans isomerase Shigella flexneri
P0A9L3 9.88e-119 338 79 0 206 1 fklB FKBP-type 22 kDa peptidyl-prolyl cis-trans isomerase Escherichia coli (strain K12)
O08437 1.41e-54 177 49 4 208 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Aeromonas hydrophila
P31106 4.64e-50 165 42 3 208 3 mip Outer membrane protein MIP Legionella micdadei
Q5ZXE0 4.81e-50 165 43 2 202 1 mip Outer membrane protein MIP Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q70YI1 6.52e-50 164 43 2 202 1 mip Outer membrane protein MIP Legionella pneumophila
A5IGB8 6.52e-50 164 43 2 202 3 mip Outer membrane protein MIP Legionella pneumophila (strain Corby)
P53605 5.79e-44 149 37 2 205 3 mip Outer membrane protein MIP Legionella longbeachae
Q9JYI8 1.37e-41 144 41 5 210 1 fkpA Probable FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P44760 3.7e-41 142 39 4 210 1 HI_0574 Probable FKBP-type peptidyl-prolyl cis-trans isomerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P51752 3.49e-39 137 34 3 204 1 mip Peptidyl-prolyl cis-trans isomerase Mip Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q09734 1.68e-35 126 52 1 123 1 MIP Macrophage infectivity potentiator Trypanosoma cruzi
P45523 2.84e-32 120 34 6 218 1 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Escherichia coli (strain K12)
P65764 3.13e-32 120 34 6 218 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P65765 3.13e-32 120 34 6 218 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Escherichia coli O157:H7
Q89A61 2.27e-30 115 30 6 220 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q6CGG3 2.14e-26 101 56 1 89 3 FPR2 FK506-binding protein 2 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q554J3 2.12e-25 98 48 1 103 3 fkbp1 FK506-binding protein 1 Dictyostelium discoideum
P57599 8.2e-24 97 31 6 221 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q41649 8.35e-23 92 48 1 89 1 FKBP15 FK506-binding protein 2 Vicia faba
Q38936 1.72e-22 92 44 4 122 2 FKBP15-2 Peptidyl-prolyl cis-trans isomerase FKBP15-2 Arabidopsis thaliana
P0CP97 1.77e-22 91 52 3 97 3 FPR2 FK506-binding protein 2 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CP96 1.89e-22 91 52 3 97 3 FPR2 FK506-binding protein 2 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q6BP84 2.04e-22 91 54 2 87 3 FPR2 FK506-binding protein 2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q8K943 3e-22 94 31 5 211 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q38935 3.2e-22 91 48 1 89 2 FKBP15-1 Peptidyl-prolyl cis-trans isomerase FKBP15-1 Arabidopsis thaliana
Q6FSC1 6.87e-22 89 53 2 88 3 FPR2 FK506-binding protein 2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P32472 7.61e-22 89 54 2 88 1 FPR2 Peptidyl-prolyl cis-trans isomerase FPR2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P20080 1.33e-21 88 48 2 107 1 fkr-2 FK506-binding protein 1A Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P26883 1.77e-21 87 46 2 106 1 Fkbp1a Peptidyl-prolyl cis-trans isomerase FKBP1A Mus musculus
P56989 2.1e-21 87 46 1 99 3 fbp FK506-binding protein Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q54SR7 2.29e-21 88 50 1 87 3 fkbp2 FK506-binding protein 2 Dictyostelium discoideum
P30417 4.72e-21 90 44 2 119 3 fkl Probable FKBP-type 25 kDa peptidyl-prolyl cis-trans isomerase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A0W2 4.88e-21 87 44 1 106 1 fbp FK506-binding protein Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q6FMA3 6.29e-21 86 43 2 110 1 FPR1 FK506-binding protein 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q62658 6.41e-21 86 45 2 106 1 Fkbp1a Peptidyl-prolyl cis-trans isomerase FKBP1A Rattus norvegicus
Q6CUZ8 6.6e-21 87 48 2 91 3 FPR2 FK506-binding protein 2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P45878 8.34e-21 87 50 3 106 1 Fkbp2 Peptidyl-prolyl cis-trans isomerase FKBP2 Mus musculus
O42993 9.14e-21 86 46 2 106 3 fkh1 Peptidyl-prolyl cis-trans isomerase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q32PA9 1.08e-20 87 50 3 106 2 FKBP2 Peptidyl-prolyl cis-trans isomerase FKBP2 Bos taurus
P0A0W3 1.14e-20 85 49 1 89 3 fbp FK506-binding protein Neisseria meningitidis serogroup C
P26885 1.24e-20 86 50 3 106 1 FKBP2 Peptidyl-prolyl cis-trans isomerase FKBP2 Homo sapiens
P48375 1.43e-20 85 45 2 106 3 Fkbp12 Peptidyl-prolyl cis-trans isomerase Fkbp12 Drosophila melanogaster
P62943 2.29e-20 85 45 2 106 1 FKBP1A Peptidyl-prolyl cis-trans isomerase FKBP1A Oryctolagus cuniculus
P62942 2.29e-20 85 45 2 106 1 FKBP1A Peptidyl-prolyl cis-trans isomerase FKBP1A Homo sapiens
P0C1J3 2.72e-20 85 46 2 106 3 FKBP1 FK506-binding protein 1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P20081 2.81e-20 85 46 2 108 1 FPR1 FK506-binding protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54NB6 6.27e-20 89 40 0 118 1 fkbp4 FK506-binding protein 4 Dictyostelium discoideum
Q6BX45 6.33e-20 84 44 2 104 3 FPR1 FK506-binding protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P26623 7.09e-20 87 37 2 143 3 mip Peptidyl-prolyl cis-trans isomerase Mip Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q6CX30 1.01e-19 83 45 2 110 3 FPR1 FK506-binding protein 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P0C1J5 1.13e-19 86 55 2 88 3 FKBP3 FK506-binding protein 2B Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P18203 1.86e-19 82 44 2 106 1 FKBP1A Peptidyl-prolyl cis-trans isomerase FKBP1A Bos taurus
Q4WLV6 1.9e-19 82 50 1 92 1 fpr1A FK506-binding protein 1A Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q754K8 3.21e-19 82 44 2 108 3 FPR1 FK506-binding protein 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q4HZB8 5.05e-19 81 44 2 109 3 FPR1 FK506-binding protein 1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9PJK1 6.11e-19 84 38 2 120 3 mip Peptidyl-prolyl cis-trans isomerase Mip Chlamydia muridarum (strain MoPn / Nigg)
Q5VVH2 1.81e-18 80 42 2 106 1 FKBP1C Peptidyl-prolyl cis-trans isomerase FKBP1C Homo sapiens
O42123 4.06e-18 79 42 2 106 3 fkbp1a Peptidyl-prolyl cis-trans isomerase FKBP1A Xenopus laevis
Q6KBA8 7.85e-18 78 45 3 108 3 fprA FK506-binding protein 1A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O94746 2.02e-17 77 44 2 106 1 FRR1 FK506-binding protein 1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q6CF41 2.23e-17 77 43 2 106 3 FPR1 FK506-binding protein 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q38931 2.34e-17 82 42 2 107 1 FKBP62 Peptidyl-prolyl cis-trans isomerase FKBP62 Arabidopsis thaliana
P0CP94 2.35e-17 77 44 2 106 3 FPR1 FK506-binding protein 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP95 2.35e-17 77 44 2 106 3 FPR1 FK506-binding protein 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q9SCY2 2.45e-17 79 38 4 134 1 FKBP13 Peptidyl-prolyl cis-trans isomerase FKBP13, chloroplastic Arabidopsis thaliana
Q9FJL3 3.5e-17 82 43 2 106 1 FKBP65 Peptidyl-prolyl cis-trans isomerase FKBP65 Arabidopsis thaliana
P26884 9.08e-17 78 43 4 110 1 FKBP3 Peptidyl-prolyl cis-trans isomerase FKBP3 Bos taurus
P28725 9.81e-17 76 41 3 106 1 fkbP FK506-binding protein Streptomyces anulatus
O46638 1.12e-16 78 43 4 110 2 FKBP3 Peptidyl-prolyl cis-trans isomerase FKBP3 Oryctolagus cuniculus
Q2U316 1.29e-16 75 42 4 116 3 fpr1 FK506-binding protein 1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q62446 1.82e-16 77 42 4 110 1 Fkbp3 Peptidyl-prolyl cis-trans isomerase FKBP3 Mus musculus
Q00688 2.14e-16 77 43 4 110 1 FKBP3 Peptidyl-prolyl cis-trans isomerase FKBP3 Homo sapiens
P68106 3.6e-16 74 38 2 106 1 FKBP1B Peptidyl-prolyl cis-trans isomerase FKBP1B Homo sapiens
P68107 3.6e-16 74 38 2 106 1 FKBP1B Peptidyl-prolyl cis-trans isomerase FKBP1B Bos taurus
Q5ATN7 4.83e-16 74 47 3 91 3 fkbB FK506-binding protein 2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P28870 6.39e-16 73 42 3 115 1 RBP1 FK506-binding protein 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P97534 7.24e-16 73 38 2 106 1 Fkbp1b Peptidyl-prolyl cis-trans isomerase FKBP1B Rattus norvegicus
Q9Z2I2 8.48e-16 73 38 2 106 1 Fkbp1b Peptidyl-prolyl cis-trans isomerase FKBP1B Mus musculus
Q8HYX6 1.69e-15 72 38 2 106 3 FKBP1B Peptidyl-prolyl cis-trans isomerase FKBP1B Oryctolagus cuniculus
Q4WHX4 2e-15 73 47 3 91 3 fpr2 FK506-binding protein 2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9VL78 2.11e-15 77 39 2 108 1 Fkbp59 FK506-binding protein 59 Drosophila melanogaster
Q2UPT7 2.42e-15 72 46 3 90 3 fpr2 FK506-binding protein 2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q02790 3.19e-15 76 45 1 92 1 FKBP4 Peptidyl-prolyl cis-trans isomerase FKBP4 Homo sapiens
O60046 7.21e-15 73 44 3 90 1 fkr-5 FK506-binding protein 2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P27124 7.33e-15 75 46 1 91 1 FKBP4 Peptidyl-prolyl cis-trans isomerase FKBP4 Oryctolagus cuniculus
Q9QVC8 8.3e-15 75 47 1 87 1 Fkbp4 Peptidyl-prolyl cis-trans isomerase FKBP4 Rattus norvegicus
Q9Z7P3 8.47e-15 73 35 2 120 3 mip Peptidyl-prolyl cis-trans isomerase Mip Chlamydia pneumoniae
P30416 1.11e-14 75 46 1 91 1 Fkbp4 Peptidyl-prolyl cis-trans isomerase FKBP4 Mus musculus
P0C1J6 1.49e-14 74 39 2 111 3 FKBP4 FK506-binding protein 4 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q7SCN0 1.83e-14 74 40 3 118 3 fkr-4 FK506-binding protein 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q8I4V8 2.51e-14 73 41 2 96 1 FKBP35 Peptidyl-prolyl cis-trans isomerase FKBP35 Plasmodium falciparum (isolate 3D7)
Q9TRY0 3.03e-14 73 46 1 91 1 FKBP4 Peptidyl-prolyl cis-trans isomerase FKBP4 Bos taurus
Q4IN00 3.96e-14 70 47 3 90 3 FPR2 FK506-binding protein 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q43207 7.73e-14 72 44 1 89 1 FKBP70 70 kDa peptidyl-prolyl isomerase Triticum aestivum
Q43207 4.05e-06 50 39 4 92 1 FKBP70 70 kDa peptidyl-prolyl isomerase Triticum aestivum
Q43207 0.000149 45 30 4 113 1 FKBP70 70 kDa peptidyl-prolyl isomerase Triticum aestivum
P42458 2.48e-13 67 41 2 101 3 Cgl0830 Probable FK506-binding protein Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6M981 2.52e-13 67 42 2 99 3 fkr-3 FK506-binding protein 1B Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q10175 2.83e-13 70 41 3 97 1 SPAC27F1.06c Probable peptidyl-prolyl cis-trans isomerase C27F1.06c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0C1B0 2.92e-13 70 42 3 96 3 fpr4 FK506-binding protein 4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q86ZF2 5.83e-13 67 43 3 93 3 FPR2 FK506-binding protein 2 Podospora anserina
Q4W9R2 5.95e-13 66 40 3 113 3 fpr1B FK506-binding protein 1B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q61576 5.99e-13 70 44 1 88 1 Fkbp10 Peptidyl-prolyl cis-trans isomerase FKBP10 Mus musculus
Q61576 4.96e-10 61 36 1 87 1 Fkbp10 Peptidyl-prolyl cis-trans isomerase FKBP10 Mus musculus
Q61576 1.54e-08 57 39 1 87 1 Fkbp10 Peptidyl-prolyl cis-trans isomerase FKBP10 Mus musculus
Q61576 1.61e-07 54 41 2 85 1 Fkbp10 Peptidyl-prolyl cis-trans isomerase FKBP10 Mus musculus
P54397 6.98e-13 69 44 3 94 1 Fkbp39 39 kDa FK506-binding nuclear protein Drosophila melanogaster
P0CP98 7e-13 69 38 3 119 3 FPR4 FK506-binding protein 4 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP99 7e-13 69 38 3 119 3 FPR4 FK506-binding protein 4 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q2YDL5 7.29e-13 67 43 2 88 2 FKBP11 Peptidyl-prolyl cis-trans isomerase FKBP11 Bos taurus
Q9FLB3 1.08e-12 65 47 3 86 2 FKBP15-3 Peptidyl-prolyl cis-trans isomerase FKBP15-3 Arabidopsis thaliana
G0SC91 1.66e-12 68 48 3 87 3 FPR4 FK506-binding protein 4 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q93ZG9 2.03e-12 68 41 4 92 1 FKBP53 Peptidyl-prolyl cis-trans isomerase FKBP53 Arabidopsis thaliana
Q9XSH5 2.92e-12 68 41 1 91 1 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Saimiri boliviensis boliviensis
Q4PIN7 2.95e-12 67 36 3 122 3 FPR4 FK506-binding protein 4 Ustilago maydis (strain 521 / FGSC 9021)
Q4INZ9 3.55e-12 67 41 3 98 3 FPR4 FK506-binding protein 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9XSI2 4.92e-12 67 41 1 89 2 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Saguinus oedipus
Q9SCY3 5.09e-12 65 35 3 123 1 PNSL4 Photosynthetic NDH subunit of lumenal location 4, chloroplastic Arabidopsis thaliana
Q4WMV5 6.07e-12 67 37 3 106 3 fpr4 FK506-binding protein 4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q96AY3 6.56e-12 67 42 1 87 1 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Homo sapiens
Q96AY3 1.42e-09 60 36 1 87 1 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Homo sapiens
Q96AY3 2.13e-08 57 39 1 87 1 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Homo sapiens
Q96AY3 6e-08 55 42 2 85 1 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Homo sapiens
Q9XT11 6.61e-12 67 39 1 91 2 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Aotus nancymaae
O22870 6.63e-12 65 35 3 131 1 FKBP16-3 Peptidyl-prolyl cis-trans isomerase FKBP16-3, chloroplastic Arabidopsis thaliana
Q13451 8.62e-12 66 36 2 112 1 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Homo sapiens
Q5RF88 9.75e-12 66 36 2 112 2 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Pongo abelii
P59024 1.2e-11 64 43 4 90 1 Fkbp14 Peptidyl-prolyl cis-trans isomerase FKBP14 Mus musculus
Q2UN37 1.29e-11 66 37 3 106 3 fpr4 FK506-binding protein 4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q26486 1.83e-11 65 36 3 106 2 FKBP46 46 kDa FK506-binding nuclear protein Spodoptera frugiperda
Q64378 2.27e-11 65 39 1 91 1 Fkbp5 Peptidyl-prolyl cis-trans isomerase FKBP5 Mus musculus
Q9D1M7 2.36e-11 63 40 2 88 1 Fkbp11 Peptidyl-prolyl cis-trans isomerase FKBP11 Mus musculus
Q5R941 2.41e-11 63 43 4 90 2 FKBP14 Peptidyl-prolyl cis-trans isomerase FKBP14 Pongo abelii
Q9NWM8 2.41e-11 63 43 4 90 1 FKBP14 Peptidyl-prolyl cis-trans isomerase FKBP14 Homo sapiens
Q95L05 3.19e-11 65 35 2 112 2 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Chlorocebus aethiops
Q66H94 3.52e-11 65 43 1 88 2 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Rattus norvegicus
Q66H94 4.58e-10 61 43 1 87 2 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Rattus norvegicus
Q66H94 4.57e-09 58 37 2 87 2 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Rattus norvegicus
Q66H94 1.84e-08 57 34 1 93 2 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Rattus norvegicus
Q2HJ89 3.97e-11 64 40 1 88 2 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Bos taurus
Q2HJ89 6.29e-10 61 37 1 87 2 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Bos taurus
Q2HJ89 2.18e-08 57 39 1 87 2 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Bos taurus
Q2HJ89 6.14e-07 52 41 2 85 2 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Bos taurus
O95302 4.22e-11 64 43 1 88 1 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Homo sapiens
O95302 8.45e-10 60 32 4 131 1 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Homo sapiens
O95302 5.74e-09 58 41 1 87 1 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Homo sapiens
O95302 9.63e-09 57 34 1 93 1 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Homo sapiens
Q2KJC8 4.23e-11 64 43 1 88 2 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Bos taurus
Q2KJC8 2.48e-09 59 32 4 131 2 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Bos taurus
Q2KJC8 3.42e-09 59 42 1 87 2 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Bos taurus
Q2KJC8 1.73e-08 57 34 1 93 2 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Bos taurus
Q9Z247 5.1e-11 64 42 1 88 1 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Mus musculus
Q9Z247 3.75e-10 62 43 1 87 1 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Mus musculus
Q9Z247 1.45e-09 60 37 2 87 1 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Mus musculus
Q9Z247 8.6e-09 58 34 1 93 1 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Mus musculus
Q9NYL4 5.88e-11 62 39 2 88 1 FKBP11 Peptidyl-prolyl cis-trans isomerase FKBP11 Homo sapiens
Q6FKH7 9.58e-11 63 38 3 109 3 FPR3 FK506-binding protein 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q54Y27 2.25e-10 62 34 1 98 3 fkbp6 FK506-binding protein 6 Dictyostelium discoideum
Q6C4C9 8.56e-10 60 36 3 107 3 FPR3 FK506-binding protein 3 Yarrowia lipolytica (strain CLIB 122 / E 150)
P38911 1.32e-09 60 35 3 119 1 FPR3 Peptidyl-prolyl cis-trans isomerase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FK71 2.76e-09 59 33 3 118 3 FPR4 FK506-binding protein 4 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P0C1J7 7.37e-09 58 36 2 104 3 FKBP5 FK506-binding protein 5 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q06205 1.21e-08 57 33 3 119 1 FPR4 FK506-binding protein 4 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8LGG0 1.51e-08 53 38 4 110 1 FKBP12 Peptidyl-prolyl cis-trans isomerase FKBP12 Arabidopsis thaliana
O74191 3.67e-08 55 33 3 105 1 fkbp39 FK506-binding protein 39 kDa Schizosaccharomyces pombe (strain 972 / ATCC 24843)
F4J9Q6 3.72e-08 56 37 3 96 1 FKBP43 Peptidyl-prolyl cis-trans isomerase FKBP43 Arabidopsis thaliana
Q54G21 4.46e-08 56 39 3 91 1 fkbp5 FK506-binding protein 5 Dictyostelium discoideum
Q54N80 1.24e-07 53 36 2 88 2 fkbp3 FK506-binding protein 3 Dictyostelium discoideum
P0CY37 2.47e-07 50 37 3 110 3 FKBP3 FK506-binding protein 1B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5RET2 4.09e-07 52 39 4 94 2 FKBP7 Peptidyl-prolyl cis-trans isomerase FKBP7 Pongo abelii
Q9Y680 4.09e-07 52 39 4 94 1 FKBP7 Peptidyl-prolyl cis-trans isomerase FKBP7 Homo sapiens
Q9M2S7 4.99e-07 51 39 2 84 1 FKBP20-1 Peptidyl-prolyl cis-trans isomerase FKBP20-1 Arabidopsis thaliana
O04287 6.69e-07 49 33 2 108 1 FKBP12 Peptidyl-prolyl cis-trans isomerase FKBP12 Vicia faba
Q756V1 1.64e-06 51 35 3 96 3 FPR3 FK506-binding protein 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q6CWE8 4.68e-06 49 32 3 107 3 FPR3 FK506-binding protein 3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
O75344 1.17e-05 48 33 2 111 1 FKBP6 Inactive peptidyl-prolyl cis-trans isomerase FKBP6 Homo sapiens
Q9SR70 1.75e-05 47 29 5 148 1 FKBP16-4 Peptidyl-prolyl cis-trans isomerase FKBP16-4, chloroplastic Arabidopsis thaliana
O52980 8.87e-05 44 34 2 78 1 None Short-type peptidyl-prolyl cis-trans isomerase Methanothermococcus thermolithotrophicus
F6PHZ6 0.000167 45 31 2 111 1 FKBP6 Inactive peptidyl-prolyl cis-trans isomerase FKBP6 Equus caballus
A6QQ71 0.000218 44 31 2 111 2 FKBP6 Inactive peptidyl-prolyl cis-trans isomerase FKBP6 Bos taurus
Q6BSE7 0.000436 43 30 3 96 3 FPR3 FK506-binding protein 3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q75LS8 0.000511 42 43 0 46 5 FKBP9P1 Putative FK506-binding protein 9-like protein Homo sapiens
Q5T1M5 0.001 43 33 4 121 1 FKBP15 FK506-binding protein 15 Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09740
Feature type CDS
Gene -
Product peptidylprolyl isomerase
Location 49702 - 50322 (strand: 1)
Length 621 (nucleotides) / 206 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1377
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00254 FKBP-type peptidyl-prolyl cis-trans isomerase
PF01346 Domain amino terminal to FKBP-type peptidyl-prolyl isomerase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0545 Posttranslational modification, protein turnover, chaperones (O) O FKBP-type peptidyl-prolyl cis-trans isomerase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03773 FKBP-type peptidyl-prolyl cis-trans isomerase FklB [EC:5.2.1.8] - -

Protein Sequence

MTQPTFDTMEAQASYGIGLQIGQQLQESGLSGLVPEAILAGITDALANNQPAVAVDVLHRALREMHERADAVRNEMQAELVKDGMRFLEENAKKEGVSSTESGLQFSVITQGDGPIPARTDRVRVHYTGRLTDGTVFDSSVQRGEPAEFPVNGVIAGWIEALTLMPVGSKWELYIPSNLAYGERGAGASIPPYSTLVFEVELLEIL

Flanking regions ( +/- flanking 50bp)

ACATGCTGCTGTTATGCTTGTCCGTCTTACTTATTAATCAGGTATCTCTCATGACACAACCGACTTTTGACACGATGGAAGCACAGGCAAGCTACGGAATTGGCTTACAAATCGGCCAGCAATTACAGGAATCCGGACTGAGCGGATTAGTACCGGAAGCGATTCTTGCCGGTATCACTGACGCATTAGCCAATAATCAGCCTGCTGTCGCGGTTGATGTTCTTCATCGTGCCCTGCGTGAAATGCATGAGCGTGCTGATGCTGTCCGCAATGAAATGCAGGCAGAGCTGGTAAAAGATGGCATGCGCTTTCTGGAAGAGAACGCAAAGAAAGAAGGTGTTTCATCCACTGAGAGCGGTTTACAGTTCTCTGTTATCACTCAGGGTGATGGTCCGATTCCGGCGCGCACTGACCGTGTCCGCGTCCACTATACCGGTCGTCTGACTGACGGCACTGTGTTTGACAGCTCTGTACAGCGCGGTGAGCCGGCTGAATTCCCGGTCAATGGCGTGATCGCAGGCTGGATCGAAGCACTGACCCTGATGCCGGTTGGTTCTAAATGGGAACTGTATATCCCGAGCAACCTGGCTTACGGTGAGCGTGGTGCCGGTGCTTCTATCCCGCCATACAGCACACTGGTCTTTGAAGTTGAGCTGTTAGAGATCCTGTAAGTACGGATTGTGTTACCAAAAGCAGAATATTCGAAATGGCCGGTTTTCAC