Homologs in group_2781

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08370 FBDBKF_08370 92.4 Morganella morganii S1 corA magnesium/cobalt transporter CorA
EHELCC_13155 EHELCC_13155 92.4 Morganella morganii S2 corA magnesium/cobalt transporter CorA
NLDBIP_13495 NLDBIP_13495 92.4 Morganella morganii S4 corA magnesium/cobalt transporter CorA
LHKJJB_13060 LHKJJB_13060 92.4 Morganella morganii S3 corA magnesium/cobalt transporter CorA
HKOGLL_11970 HKOGLL_11970 92.4 Morganella morganii S5 corA magnesium/cobalt transporter CorA

Distribution of the homologs in the orthogroup group_2781

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2781

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q66FY7 0.0 541 81 0 316 3 corA Magnesium transport protein CorA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZAG5 0.0 541 81 0 316 3 corA Magnesium transport protein CorA Yersinia pestis
Q7MYP0 0.0 538 81 0 316 3 corA Magnesium transport protein CorA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6CZH4 0.0 531 80 0 316 3 corA Magnesium transport protein CorA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3YVE9 0.0 521 78 0 316 3 corA Magnesium transport protein CorA Shigella sonnei (strain Ss046)
P0ABI7 0.0 521 78 0 316 3 corA Magnesium transport protein CorA Shigella flexneri
Q329Z2 0.0 521 78 0 316 3 corA Magnesium transport protein CorA Shigella dysenteriae serotype 1 (strain Sd197)
Q31UH1 0.0 521 78 0 316 3 corA Magnesium transport protein CorA Shigella boydii serotype 4 (strain Sb227)
P0ABI4 0.0 521 78 0 316 1 corA Magnesium transport protein CorA Escherichia coli (strain K12)
P0ABI5 0.0 521 78 0 316 3 corA Magnesium transport protein CorA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ABI6 0.0 521 78 0 316 3 corA Magnesium transport protein CorA Escherichia coli O157:H7
P0A2R8 0.0 520 78 0 316 1 corA Magnesium transport protein CorA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2R9 0.0 520 78 0 316 3 corA Magnesium transport protein CorA Salmonella typhi
Q5PKM1 0.0 520 78 0 316 3 corA Magnesium transport protein CorA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57HQ5 0.0 520 78 0 316 3 corA Magnesium transport protein CorA Salmonella choleraesuis (strain SC-B67)
Q2NQF9 0.0 508 77 0 316 3 corA Magnesium transport protein CorA Sodalis glossinidius (strain morsitans)
P44998 8.05e-162 456 69 1 316 3 corA Magnesium transport protein CorA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLP6 8.7e-162 456 69 1 316 3 corA Magnesium transport protein CorA Haemophilus influenzae (strain 86-028NP)
Q9CLC4 1.01e-160 453 69 0 316 3 corA Magnesium transport protein CorA Pasteurella multocida (strain Pm70)
Q8D2T1 1.31e-160 453 67 1 316 3 corA Magnesium transport protein CorA Wigglesworthia glossinidia brevipalpis
Q65VT3 3.53e-160 452 68 0 316 3 corA Magnesium transport protein CorA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7VN59 6.34e-145 413 65 1 317 3 corA Magnesium transport protein CorA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q491Z9 2.52e-109 323 54 1 262 3 corA Magnesium transport protein CorA Blochmanniella pennsylvanica (strain BPEN)
Q7VRM7 3.38e-101 302 47 2 317 3 corA Magnesium transport protein CorA Blochmanniella floridana
Q7M9C0 2.26e-51 175 31 3 304 3 corA Magnesium transport protein CorA Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9PPI1 4.25e-50 172 28 3 322 3 corA Magnesium transport protein CorA Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HV55 5.21e-50 172 29 3 322 3 corA Magnesium transport protein CorA Campylobacter jejuni (strain RM1221)
Q7VFJ7 1.3e-46 162 28 1 290 3 corA Magnesium transport protein CorA Helicobacter hepaticus (strain ATCC 51449 / 3B1)
O25901 2.84e-36 135 26 4 305 1 corA Magnesium transport protein CorA Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJP2 1.05e-35 134 26 4 305 3 corA Magnesium transport protein CorA Helicobacter pylori (strain J99 / ATCC 700824)
Q9WZ31 6.22e-16 80 23 3 212 1 corA Cobalt/magnesium transport protein CorA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O31543 8.7e-11 65 41 0 62 3 yfjQ Putative metal ion transporter YfjQ Bacillus subtilis (strain 168)
P40948 1.43e-08 58 23 6 222 1 corA Magnesium transport protein CorA Bacillus subtilis (strain 168)
Q58439 4.85e-07 53 23 1 124 1 corA Cobalt/magnesium transport protein CorA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09570
Feature type CDS
Gene corA
Product magnesium/cobalt transporter CorA
Location 14522 - 15472 (strand: 1)
Length 951 (nucleotides) / 316 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2781
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01544 CorA-like Mg2+ transporter protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0598 Inorganic ion transport and metabolism (P) P Mg2+ and Co2+ transporter CorA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03284 magnesium transporter - -

Protein Sequence

MLSAFRVDNKRLHRLDLEEGDTLADALWVDVSEPEESERAFIQAQLNQELATSPELDDIEASARFFEDDDGLHVHSFFYYEDADDHAGNSTVAFTLRDGRLYTLRERELPAFRLYRMRARKQTMLDGNGYEILLDLFETKIEQLADVIENIYSELESLSRAIMKGKQDDAFDKALSNLAVQEDIGWKVRLCLMDTQRALNFLVRRTRLPVNQLEQAREILRDIESLLPHNESLFQKVNFLMQAAMGFMNIEQSRIIKIFSVVSVVFLPPTLVASSYGMNFRFMPELDWAMGYPAAIGIMFVAALAPYLYFKRKNWL

Flanking regions ( +/- flanking 50bp)

TACCATGCGCACACTTTTTCTTTTCCCGACGCTCCCGGAGGCCACACACTATGCTGAGCGCATTTAGAGTTGATAATAAGCGTTTACACCGTCTTGATTTAGAAGAGGGTGATACCCTTGCTGATGCGCTGTGGGTGGATGTTTCCGAACCGGAAGAGAGCGAACGTGCCTTTATCCAGGCACAGTTAAACCAGGAGCTGGCGACCAGCCCGGAGCTGGATGATATCGAAGCATCCGCCCGTTTCTTTGAAGATGATGACGGTCTGCATGTTCACTCCTTTTTCTATTACGAGGATGCGGACGATCACGCCGGAAACTCAACCGTGGCGTTTACGCTGCGCGACGGGCGTTTATATACCCTGCGCGAACGTGAGCTGCCCGCGTTTCGTCTTTACCGCATGCGCGCCCGCAAGCAGACCATGCTGGACGGCAACGGATACGAAATTCTGCTGGATTTGTTTGAAACCAAAATTGAACAGCTCGCAGATGTGATTGAAAATATCTACAGTGAACTGGAATCCCTCAGCCGCGCCATTATGAAAGGCAAGCAGGATGATGCGTTTGATAAGGCGCTGTCTAATCTGGCGGTGCAGGAAGATATCGGCTGGAAAGTGCGTTTGTGTCTGATGGATACACAGCGCGCACTGAACTTTTTAGTCCGCCGCACACGCCTGCCGGTTAATCAGCTGGAGCAGGCACGCGAGATCCTGCGCGATATTGAATCCCTGCTGCCGCATAACGAATCGCTCTTTCAGAAGGTTAACTTCCTGATGCAGGCGGCGATGGGCTTTATGAATATTGAGCAAAGCCGCATCATCAAAATCTTCTCCGTGGTATCTGTGGTCTTCCTGCCACCAACGCTGGTTGCCTCCAGCTACGGGATGAACTTTAGGTTTATGCCTGAACTGGACTGGGCGATGGGCTATCCGGCGGCTATCGGAATTATGTTTGTGGCGGCACTTGCACCGTATCTCTATTTCAAACGTAAGAACTGGCTGTAAGCAGACGTCAGAAAACGGTATCAGAAAAAGGTAAATGATATGCCCTTGGC