Homologs in group_1613

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10615 FBDBKF_10615 37.3 Morganella morganii S1 hipB Transcriptional regulator, contains XRE-family HTH domain
EHELCC_14950 EHELCC_14950 37.3 Morganella morganii S2 hipB Transcriptional regulator, contains XRE-family HTH domain
NLDBIP_14780 NLDBIP_14780 37.3 Morganella morganii S4 hipB Transcriptional regulator, contains XRE-family HTH domain
LHKJJB_14565 LHKJJB_14565 37.3 Morganella morganii S3 hipB Transcriptional regulator, contains XRE-family HTH domain
HKOGLL_13185 HKOGLL_13185 37.3 Morganella morganii S5 hipB Transcriptional regulator, contains XRE-family HTH domain
F4V73_RS14325 F4V73_RS14325 35.8 Morganella psychrotolerans - helix-turn-helix transcriptional regulator

Distribution of the homologs in the orthogroup group_1613

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1613

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07900
Feature type CDS
Gene -
Product helix-turn-helix transcriptional regulator
Location 1648885 - 1649160 (strand: 1)
Length 276 (nucleotides) / 91 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1613
Orthogroup size 7
N. genomes 6

Actions

Genomic region

Domains

PF01381 Helix-turn-helix

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1396 Transcription (K) K Transcriptional regulator, contains XRE-family HTH domain

Protein Sequence

MRKKSIPWATAREDILSDPEVNAIYEAELRAERIREQLQSWRSSAVLTSSQVAARPGITPAAVSRTERNAEKATVETLARYAAACGVKIRK

Flanking regions ( +/- flanking 50bp)

TTCATCCATGTTAGCTACCGCTGCACGGCGGTTAGAGGAGATGCTGAACGATGCGTAAAAAATCCATTCCGTGGGCAACAGCCCGCGAAGACATTTTATCCGACCCCGAAGTTAATGCGATCTATGAAGCAGAACTGCGGGCGGAACGAATCAGGGAACAGTTACAGTCATGGCGCAGTTCTGCCGTGCTGACCAGCTCACAGGTCGCTGCACGTCCGGGGATCACACCTGCGGCAGTATCGCGGACAGAACGCAATGCCGAAAAAGCAACGGTTGAGACATTAGCTCGCTATGCGGCTGCGTGTGGCGTAAAAATCCGAAAATAATGTTGTAAGGATCGCTGAGATGAACACGGGCAGACGGTGGCTGAAAGCAC