Homologs in group_533

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01180 FBDBKF_01180 90.0 Morganella morganii S1 nadE NAD+ synthase
EHELCC_00365 EHELCC_00365 90.0 Morganella morganii S2 nadE NAD+ synthase
NLDBIP_03095 NLDBIP_03095 90.0 Morganella morganii S4 nadE NAD+ synthase
LHKJJB_04610 LHKJJB_04610 90.0 Morganella morganii S3 nadE NAD+ synthase
HKOGLL_02435 HKOGLL_02435 90.0 Morganella morganii S5 nadE NAD+ synthase
PMI_RS09235 PMI_RS09235 76.6 Proteus mirabilis HI4320 - NAD+ synthase

Distribution of the homologs in the orthogroup group_533

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_533

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6F8K4 0.0 537 51 4 537 1 nadE Glutamine-dependent NAD(+) synthetase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9PC24 1.46e-167 489 47 5 543 3 nadE Glutamine-dependent NAD(+) synthetase Xylella fastidiosa (strain 9a5c)
Q87D47 1.34e-165 484 47 5 543 3 nadE Glutamine-dependent NAD(+) synthetase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
O67091 1.7e-160 471 43 6 566 3 nadE Glutamine-dependent NAD(+) synthetase Aquifex aeolicus (strain VF5)
P74292 1.37e-143 428 42 6 559 3 nadE Glutamine-dependent NAD(+) synthetase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9X0Y0 7.24e-138 414 39 8 577 3 nadE2 Glutamine-dependent NAD(+) synthetase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q03638 5.15e-132 398 44 5 547 1 nadE Glutamine-dependent NAD(+) synthetase Rhodobacter capsulatus
B3ELE3 1.03e-42 157 38 4 264 3 nadE NH(3)-dependent NAD(+) synthetase Chlorobium phaeobacteroides (strain BS1)
B3E4K8 7.35e-42 154 38 4 268 3 nadE NH(3)-dependent NAD(+) synthetase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A5G7Y9 1.42e-41 153 39 5 264 3 nadE NH(3)-dependent NAD(+) synthetase Geotalea uraniireducens (strain Rf4)
A1BEN4 4.01e-40 149 38 5 258 3 nadE NH(3)-dependent NAD(+) synthetase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8KEX2 4.53e-40 149 36 5 266 3 nadE NH(3)-dependent NAD(+) synthetase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8REA7 1.13e-38 145 36 3 252 3 nadE NH(3)-dependent NAD(+) synthetase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B4SEZ8 1.31e-38 145 36 4 254 3 nadE NH(3)-dependent NAD(+) synthetase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q8U4I9 4.51e-38 143 35 7 258 3 nadE NH(3)-dependent NAD(+) synthetase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
B3QM51 1.32e-36 140 34 5 264 3 nadE NH(3)-dependent NAD(+) synthetase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
O57921 7.92e-36 137 32 6 255 1 nadE NH(3)-dependent NAD(+) synthetase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A4SFG4 8.9e-34 132 36 5 261 3 nadE NH(3)-dependent NAD(+) synthetase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q7MAJ5 1.36e-33 131 33 5 261 3 nadE NH(3)-dependent NAD(+) synthetase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q58747 3.95e-32 127 34 6 262 3 nadE NH(3)-dependent NAD(+) synthetase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q3B5D4 5.45e-32 127 35 5 256 3 nadE NH(3)-dependent NAD(+) synthetase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B5ZA97 1.62e-31 125 31 7 270 3 nadE NH(3)-dependent NAD(+) synthetase Helicobacter pylori (strain G27)
Q8PZP6 2.97e-31 125 34 6 246 3 nadE NH(3)-dependent NAD(+) synthetase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O29262 4.04e-31 124 35 6 247 3 nadE NH(3)-dependent NAD(+) synthetase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
B6JKQ6 5.48e-31 124 31 7 268 3 nadE NH(3)-dependent NAD(+) synthetase Helicobacter pylori (strain P12)
Q9ZMB0 8.58e-31 124 31 7 268 3 nadE NH(3)-dependent NAD(+) synthetase Helicobacter pylori (strain J99 / ATCC 700824)
B2USG0 1.24e-30 123 30 7 270 3 nadE NH(3)-dependent NAD(+) synthetase Helicobacter pylori (strain Shi470)
O25096 7.72e-30 121 30 7 268 1 nadE NH(3)-dependent NAD(+) synthetase Helicobacter pylori (strain ATCC 700392 / 26695)
Q17X65 1.18e-29 120 30 6 253 3 nadE NH(3)-dependent NAD(+) synthetase Helicobacter acinonychis (strain Sheeba)
Q1CUH2 2.88e-29 119 31 7 257 3 nadE NH(3)-dependent NAD(+) synthetase Helicobacter pylori (strain HPAG1)
Q9HNM7 3.68e-29 119 35 6 246 3 nadE NH(3)-dependent NAD(+) synthetase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6W9 3.68e-29 119 35 6 246 3 nadE NH(3)-dependent NAD(+) synthetase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q5JJ65 5.59e-29 118 34 7 244 3 nadE NH(3)-dependent NAD(+) synthetase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8TK88 7.21e-29 118 33 6 246 3 nadE NH(3)-dependent NAD(+) synthetase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
C6A5B5 1.28e-28 117 31 7 261 3 nadE NH(3)-dependent NAD(+) synthetase Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q8TVH1 1.71e-28 118 33 6 257 3 nadE NH(3)-dependent NAD(+) synthetase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q9V2A9 9.32e-28 115 35 7 228 3 nadE NH(3)-dependent NAD(+) synthetase Pyrococcus abyssi (strain GE5 / Orsay)
Q7VHF9 2.27e-27 114 30 4 255 3 nadE NH(3)-dependent NAD(+) synthetase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A6UUS4 1.68e-26 111 32 6 242 3 nadE NH(3)-dependent NAD(+) synthetase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q12V31 1.8e-26 111 35 6 199 3 nadE NH(3)-dependent NAD(+) synthetase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A7I243 1.9e-25 108 27 5 251 3 nadE NH(3)-dependent NAD(+) synthetase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
P9WJJ3 4.13e-25 113 25 13 509 1 nadE Glutamine-dependent NAD(+) synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJJ2 4.13e-25 113 25 13 509 3 nadE Glutamine-dependent NAD(+) synthetase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5L7 4.13e-25 113 25 13 509 3 nadE Glutamine-dependent NAD(+) synthetase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q65RB5 1.4e-24 106 32 6 242 3 nadE NH(3)-dependent NAD(+) synthetase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9YAI1 3.94e-24 105 32 7 258 3 nadE NH(3)-dependent NAD(+) synthetase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
A8FLM3 7.1e-24 103 33 3 191 3 nadE NH(3)-dependent NAD(+) synthetase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9PPB0 7.38e-24 103 33 3 191 1 nadE NH(3)-dependent NAD(+) synthetase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HUY2 7.52e-24 103 33 3 191 3 nadE NH(3)-dependent NAD(+) synthetase Campylobacter jejuni (strain RM1221)
A1VZF8 7.52e-24 103 33 3 191 3 nadE NH(3)-dependent NAD(+) synthetase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7H439 1.15e-23 103 33 3 191 3 nadE NH(3)-dependent NAD(+) synthetase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A3DP41 1.72e-23 103 28 7 248 3 nadE NH(3)-dependent NAD(+) synthetase Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)
Q6L0D1 2.73e-23 102 32 3 199 3 nadE NH(3)-dependent NAD(+) synthetase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
A2BLB9 1.61e-22 100 34 6 246 3 nadE NH(3)-dependent NAD(+) synthetase Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
O27554 1.66e-22 100 34 4 193 3 nadE NH(3)-dependent NAD(+) synthetase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9HJR8 3.95e-22 99 28 5 231 3 nadE NH(3)-dependent NAD(+) synthetase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9CBZ6 4.24e-22 103 24 13 498 3 nadE Glutamine-dependent NAD(+) synthetase Mycobacterium leprae (strain TN)
A7IAS7 2.99e-21 96 32 6 227 3 nadE NH(3)-dependent NAD(+) synthetase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q979W4 5.94e-21 95 30 4 198 3 nadE NH(3)-dependent NAD(+) synthetase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
B0S1S2 2.13e-20 94 30 5 213 3 nadE NH(3)-dependent NAD(+) synthetase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
P47623 2.2e-19 91 33 5 205 3 nadE NH(3)-dependent NAD(+) synthetase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5ZMA6 2.42e-19 95 23 20 676 2 NADSYN1 Glutamine-dependent NAD(+) synthetase Gallus gallus
Q4JCP0 3.98e-19 91 31 10 279 3 nadE NH(3)-dependent NAD(+) synthetase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q0AX10 6.42e-18 87 28 7 247 3 nadE NH(3)-dependent NAD(+) synthetase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q97WN9 2.7e-17 85 29 9 245 3 nadE NH(3)-dependent NAD(+) synthetase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O74940 4.11e-17 88 22 22 680 3 SPCC553.02 Putative glutamine-dependent NAD(+) synthetase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q96YL5 4.79e-17 85 29 10 279 3 nadE NH(3)-dependent NAD(+) synthetase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q9VYA0 2.71e-16 85 21 23 694 1 Nadsyn Glutamine-dependent NAD(+) synthetase Drosophila melanogaster
Q6IA69 4.69e-16 85 24 20 590 1 NADSYN1 Glutamine-dependent NAD(+) synthetase Homo sapiens
Q4R5Y2 7.53e-16 84 23 17 590 2 NADSYN1 Glutamine-dependent NAD(+) synthetase Macaca fascicularis
Q812E8 1.52e-15 83 22 14 587 2 Nadsyn1 Glutamine-dependent NAD(+) synthetase Rattus norvegicus
Q3ABX6 1.9e-15 79 27 7 248 3 nadE NH(3)-dependent NAD(+) synthetase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A8MHN7 2.24e-15 79 27 10 258 3 nadE NH(3)-dependent NAD(+) synthetase Alkaliphilus oremlandii (strain OhILAs)
Q6F0U4 5.46e-15 78 30 11 263 3 nadE NH(3)-dependent NAD(+) synthetase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
B9KAZ2 1.92e-14 77 28 10 290 3 nadE NH(3)-dependent NAD(+) synthetase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A6TQC4 2.41e-14 76 27 7 224 3 nadE NH(3)-dependent NAD(+) synthetase Alkaliphilus metalliredigens (strain QYMF)
Q9WZB3 5.01e-14 76 26 7 286 3 nadE1 NH(3)-dependent NAD(+) synthetase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q3ZBF0 1.38e-13 77 22 16 580 2 NADSYN1 Glutamine-dependent NAD(+) synthetase Bos taurus
Q711T7 2.52e-13 76 22 16 586 1 Nadsyn1 Glutamine-dependent NAD(+) synthetase Mus musculus
Q8EWK9 6.46e-13 72 28 9 236 3 nadE NH(3)-dependent NAD(+) synthetase Malacoplasma penetrans (strain HF-2)
Q8ZXL4 7.54e-13 72 32 6 247 3 nadE NH(3)-dependent NAD(+) synthetase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
O83759 1.87e-12 73 26 7 285 3 nadE Putative glutamine-dependent NAD(+) synthetase Treponema pallidum (strain Nichols)
A7GNW5 2.49e-12 70 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7HJC1 8.56e-12 69 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain B4264)
Q739R5 1.2e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81EI2 1.21e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HJW8 1.49e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CG2 1.55e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain ZK / E33L)
B9IXY1 1.55e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain Q1)
B7JKI8 1.55e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain AH820)
Q81RP3 1.55e-11 68 30 8 218 1 nadE NH(3)-dependent NAD(+) synthetase Bacillus anthracis
A0RCZ8 1.55e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus thuringiensis (strain Al Hakam)
C3L5J1 1.55e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P7H9 1.55e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus anthracis (strain A0248)
B7ITB1 1.57e-11 68 28 6 213 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain G9842)
B7HND7 1.88e-11 68 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain AH187)
A8F9S0 1.96e-11 68 31 9 216 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus pumilus (strain SAFR-032)
C1ERC2 2.51e-11 67 30 8 218 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus cereus (strain 03BB102)
Q54ML1 8.42e-11 68 22 17 579 3 nadsyn1 Glutamine-dependent NAD(+) synthetase Dictyostelium discoideum
Q98PU6 1.5e-10 65 27 8 233 3 nadE NH(3)-dependent NAD(+) synthetase Mycoplasmopsis pulmonis (strain UAB CTIP)
B5Y8Q4 1.52e-10 65 25 7 263 3 nadE NH(3)-dependent NAD(+) synthetase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q3KIW5 2.05e-10 65 27 7 218 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas fluorescens (strain Pf0-1)
P38795 2.82e-10 66 20 20 667 1 QNS1 Glutamine-dependent NAD(+) synthetase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A9VRQ8 5.89e-10 63 30 10 219 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus mycoides (strain KBAB4)
Q92TY6 6.43e-10 64 26 7 292 3 nadE NH(3)-dependent NAD(+) synthetase Rhizobium meliloti (strain 1021)
Q65NN6 9.09e-10 63 28 10 223 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P08164 1.64e-09 62 29 10 227 1 nadE NH(3)-dependent NAD(+) synthetase Bacillus subtilis (strain 168)
Q6AER9 2.86e-09 62 27 7 224 3 nadE NH(3)-dependent NAD(+) synthetase Leifsonia xyli subsp. xyli (strain CTCB07)
Q39AM3 4.17e-09 61 27 8 252 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A7Z159 4.27e-09 61 27 11 257 3 nadE NH(3)-dependent NAD(+) synthetase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q88DF6 4.4e-09 61 30 9 220 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1I469 7.35e-09 60 30 8 208 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas entomophila (strain L48)
B1Z0R0 7.71e-09 60 27 10 254 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia ambifaria (strain MC40-6)
B1J649 8.44e-09 60 29 8 220 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas putida (strain W619)
Q75SP7 1.01e-08 60 28 9 230 1 ramA (R)-stereoselective amidase Pseudomonas sp.
Q8VYF5 1.04e-08 60 23 9 264 1 CPA N-carbamoylputrescine amidase Arabidopsis thaliana
P75216 1.11e-08 59 27 5 220 3 nadE NH(3)-dependent NAD(+) synthetase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
B4EIP2 1.3e-08 59 28 7 217 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q9XGI9 1.39e-08 60 23 10 260 2 CPA N-carbamoylputrescine amidase Solanum lycopersicum
P55176 1.4e-08 59 27 7 229 3 None Hydrolase in pqqF 5'region Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
A5W9Q7 1.41e-08 59 30 9 220 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q93XI4 1.89e-08 59 24 10 261 2 CPA N-carbamoylputrescine amidase Oryza sativa subsp. japonica
Q3HVN1 2.18e-08 59 23 10 260 2 CPA N-carbamoylputrescine amidase Solanum tuberosum
Q5YRN0 2.65e-08 58 27 9 252 3 nadE NH(3)-dependent NAD(+) synthetase Nocardia farcinica (strain IFM 10152)
A6VD32 3.66e-08 58 28 7 217 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas aeruginosa (strain PA7)
Q0D8D4 3.85e-08 60 22 17 589 3 Os07g0167100 Glutamine-dependent NAD(+) synthetase Oryza sativa subsp. japonica
A2YII8 3.85e-08 60 22 17 589 3 OsI_25032 Glutamine-dependent NAD(+) synthetase Oryza sativa subsp. indica
Q1BQX0 4.03e-08 58 27 7 217 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia orbicola (strain AU 1054)
B1K5T6 4.03e-08 58 27 7 217 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia orbicola (strain MC0-3)
A0B2Y5 4.03e-08 58 27 7 217 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia cenocepacia (strain HI2424)
Q38VA7 4.35e-08 58 28 11 235 3 nadE NH(3)-dependent NAD(+) synthetase Latilactobacillus sakei subsp. sakei (strain 23K)
B0KKX4 5.32e-08 57 30 9 208 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas putida (strain GB-1)
Q4L7M6 5.57e-08 57 29 10 220 3 nadE NH(3)-dependent NAD(+) synthetase Staphylococcus haemolyticus (strain JCSC1435)
Q9HUP3 5.99e-08 57 28 7 217 1 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V1Y3 5.99e-08 57 28 7 217 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas aeruginosa (strain LESB58)
O59829 6.82e-08 57 25 10 257 3 SPCC965.09 Probable nitrilase C965.09 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q02F98 9.64e-08 57 28 7 216 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q988H0 1.39e-07 57 24 7 284 3 nadE NH(3)-dependent NAD(+) synthetase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q92CU3 1.43e-07 56 28 9 219 3 nadE NH(3)-dependent NAD(+) synthetase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5HN23 2.56e-07 55 26 10 249 3 nadE NH(3)-dependent NAD(+) synthetase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CNP1 2.78e-07 55 26 10 249 3 nadE NH(3)-dependent NAD(+) synthetase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
C0ZXG7 3.62e-07 55 27 12 278 3 nadE NH(3)-dependent NAD(+) synthetase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
B1ME26 4.99e-07 55 24 7 234 3 nadE NH(3)-dependent NAD(+) synthetase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A0AHK4 5.12e-07 55 27 9 219 3 nadE NH(3)-dependent NAD(+) synthetase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A1UW43 5.14e-07 55 27 11 253 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia mallei (strain SAVP1)
Q62CU8 5.14e-07 55 27 11 253 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia mallei (strain ATCC 23344)
A2RXU4 5.14e-07 55 27 11 253 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia mallei (strain NCTC 10229)
A3MF00 5.14e-07 55 27 11 253 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia mallei (strain NCTC 10247)
B2GA98 5.4e-07 55 26 9 238 3 nadE NH(3)-dependent NAD(+) synthetase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q63K83 6.33e-07 54 27 11 253 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia pseudomallei (strain K96243)
Q3JL79 6.33e-07 54 27 11 253 1 nadE NH(3)-dependent NAD(+) synthetase Burkholderia pseudomallei (strain 1710b)
A3P6S9 6.33e-07 54 27 11 253 3 nadE NH(3)-dependent NAD(+) synthetase Burkholderia pseudomallei (strain 1106a)
Q87VL4 2.1e-06 53 25 8 219 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZYV8 3.36e-06 52 26 8 207 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas syringae pv. syringae (strain B728a)
Q48NY2 3.61e-06 52 26 8 206 3 nadE NH(3)-dependent NAD(+) synthetase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B2TDV9 4.37e-06 52 27 10 217 3 nadE NH(3)-dependent NAD(+) synthetase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
C1B1N8 6.39e-06 51 27 13 264 3 nadE NH(3)-dependent NAD(+) synthetase Rhodococcus opacus (strain B4)
C4L5A2 7.45e-06 51 27 10 238 3 nadE NH(3)-dependent NAD(+) synthetase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B7VQP3 7.93e-06 51 25 9 228 3 nadE NH(3)-dependent NAD(+) synthetase Vibrio atlanticus (strain LGP32)
C1C818 8.04e-06 51 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae (strain 70585)
B1YJ94 9.87e-06 50 26 7 216 3 nadE NH(3)-dependent NAD(+) synthetase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q9RYV5 1.05e-05 51 26 9 256 1 nadE NH(3)-dependent NAD(+) synthetase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9KAK2 1.67e-05 50 26 9 261 3 nadE NH(3)-dependent NAD(+) synthetase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A1S5V3 1.71e-05 50 26 9 213 3 nadE NH(3)-dependent NAD(+) synthetase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1ICL9 1.78e-05 50 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae (strain Hungary19A-6)
Q0S2M9 1.94e-05 50 25 10 262 3 nadE NH(3)-dependent NAD(+) synthetase Rhodococcus jostii (strain RHA1)
Q8CWY4 2.06e-05 50 26 12 231 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C1CQT7 2.47e-05 49 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CLC7 2.47e-05 49 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae (strain P1031)
C1CF07 2.47e-05 49 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae (strain JJA)
P65509 2.47e-05 49 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IQN8 2.47e-05 49 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae (strain CGSP14)
P65508 2.47e-05 49 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZKX7 2.47e-05 49 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04JT1 2.47e-05 49 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q74I36 2.61e-05 49 27 9 232 3 nadE NH(3)-dependent NAD(+) synthetase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B5E5S7 5.61e-05 48 29 14 236 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus pneumoniae serotype 19F (strain G54)
Q8K9W7 5.76e-05 48 22 8 269 3 nadE NH(3)-dependent NAD(+) synthetase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q041J1 6.54e-05 48 27 8 220 3 nadE NH(3)-dependent NAD(+) synthetase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B3W8T2 6.64e-05 48 24 7 227 3 nadE NH(3)-dependent NAD(+) synthetase Lacticaseibacillus casei (strain BL23)
Q037P8 7.67e-05 48 24 7 227 3 nadE NH(3)-dependent NAD(+) synthetase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B1HTT1 0.000111 47 26 13 242 3 nadE NH(3)-dependent NAD(+) synthetase Lysinibacillus sphaericus (strain C3-41)
A8FU90 0.000115 47 25 10 252 3 nadE NH(3)-dependent NAD(+) synthetase Shewanella sediminis (strain HAW-EB3)
A8AHD1 0.000233 47 28 9 210 3 nadE NH(3)-dependent NAD(+) synthetase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0MGX1 0.00026 46 26 13 230 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus equi subsp. zooepidemicus (strain H70)
A4W9K3 0.000291 46 22 9 272 3 nadE NH(3)-dependent NAD(+) synthetase Enterobacter sp. (strain 638)
B4U4I9 0.000302 46 26 13 230 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q03SX9 0.000422 45 25 9 222 3 nadE NH(3)-dependent NAD(+) synthetase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
C0M795 0.000457 45 26 13 230 3 nadE NH(3)-dependent NAD(+) synthetase Streptococcus equi subsp. equi (strain 4047)
Q830Y9 0.000516 45 28 10 223 1 nadE NH(3)-dependent NAD(+) synthetase Enterococcus faecalis (strain ATCC 700802 / V583)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07250
Feature type CDS
Gene -
Product NAD+ synthase
Location 1507950 - 1509572 (strand: -1)
Length 1623 (nucleotides) / 540 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_533
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00795 Carbon-nitrogen hydrolase
PF02540 NAD synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0171 Coenzyme transport and metabolism (H) H NH3-dependent NAD+ synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MRRTLNIALAQLNFLVGDIEGNGERILKTVAEQQQKGADLVMFSELALSGYSPEDLVFRPDFHQRTEQVLTRIEQASHDCAILVGHTWHENGHIYNALSFFEQGKLRARYFKQQLPNYGVFDEKRWFTAGTQTCAVDFKGYRLGLLICEDIWTDGPVDALKTAGADMILTLNASPYSTDKIDTRDALIQSHCRRTGLPLIYLNQVGGQDELIFDGDSAVFGADGNIMHRLAAFSEQTVQCRFDDLAITPMDSPAPTLSVLAQVYQGLVLATRDYVTKNGFQGALLGLSGGIDSGLTVAIAADALGNDKVQAVMMPFRYTAEISIHDAREQAELLGVEFDIVPIEPMFDAFMHELAPKFAGMAVDTTEENLQARCRAVILMAMSNKRRRIVLTTSNKSESAVGYSTLYGDMAGGFNVLKDVPKTMVFELARYRNTLSPAIPERVITRPPSAELAPGQLDQDSLPPYDILDALLEGYVERDLSPEELIAAGFDEAVVRKVIRLVDINEYKRRQSPVGPRITARNFGKDRRYPITSGFGRKNW

Flanking regions ( +/- flanking 50bp)

CAGTTTGAATGAATACGGGTATACATGAGAGAGACGGAGACCCGGATTTTATGCGTCGTACACTCAATATCGCCTTAGCTCAGCTGAACTTTCTGGTCGGAGACATTGAAGGCAATGGTGAACGTATCCTGAAAACGGTCGCAGAGCAGCAGCAAAAAGGCGCTGATCTGGTGATGTTTTCTGAACTGGCACTATCCGGATATTCGCCGGAAGACTTGGTTTTTCGTCCTGATTTTCATCAGCGGACAGAGCAGGTATTAACAAGAATTGAGCAGGCGAGCCATGACTGTGCGATCCTGGTGGGTCATACGTGGCATGAAAACGGGCATATATATAATGCGCTCTCTTTCTTTGAACAGGGCAAACTCCGCGCCCGTTATTTCAAACAGCAACTGCCTAATTACGGCGTATTTGATGAAAAACGCTGGTTTACCGCCGGAACGCAAACTTGTGCTGTTGATTTCAAAGGTTACCGCCTGGGGCTGCTGATTTGTGAAGATATCTGGACTGACGGGCCTGTTGATGCACTGAAAACAGCCGGGGCAGATATGATCCTGACGCTGAATGCCTCGCCGTATTCCACCGATAAAATTGATACGCGTGATGCCCTTATTCAATCACACTGTCGCCGTACCGGGCTGCCGCTGATTTATCTCAATCAGGTTGGTGGTCAGGATGAGCTTATTTTCGATGGCGATTCAGCCGTTTTCGGTGCAGATGGCAACATAATGCATCGTCTTGCCGCATTTTCTGAGCAGACAGTACAGTGCCGGTTTGATGATCTTGCTATTACGCCGATGGATTCTCCTGCACCGACACTGTCCGTTCTGGCACAGGTATATCAGGGATTGGTACTGGCTACCCGTGATTATGTGACTAAAAATGGTTTTCAGGGTGCATTACTGGGCTTATCCGGCGGTATTGATTCCGGTCTGACGGTCGCTATTGCCGCAGATGCACTGGGAAATGACAAAGTACAGGCCGTGATGATGCCATTTCGCTACACGGCGGAAATCAGTATTCATGATGCCCGTGAGCAGGCAGAACTGCTTGGCGTAGAGTTTGATATTGTCCCGATTGAGCCGATGTTTGATGCCTTTATGCACGAACTGGCACCGAAATTCGCCGGTATGGCAGTAGACACAACGGAAGAAAATTTACAGGCGCGCTGCCGGGCGGTGATCCTGATGGCGATGTCAAACAAGCGCCGCCGCATTGTGCTGACCACCAGTAATAAAAGTGAGTCCGCCGTGGGCTATTCCACATTGTACGGTGATATGGCTGGCGGATTTAACGTACTGAAAGATGTGCCGAAAACAATGGTTTTTGAGTTGGCAAGATACCGCAACACCTTGTCACCGGCGATCCCTGAGCGGGTAATTACCCGTCCGCCGTCAGCTGAGCTGGCGCCGGGTCAGTTGGATCAGGACAGTCTGCCGCCGTATGACATTCTTGATGCGTTGCTGGAAGGCTATGTTGAACGCGACTTGTCCCCGGAAGAACTGATCGCCGCCGGTTTTGATGAAGCGGTTGTCCGTAAAGTTATCCGGCTGGTTGATATTAATGAATATAAACGCCGCCAGTCACCGGTAGGGCCGCGTATTACCGCCCGCAACTTTGGCAAAGATCGCCGTTACCCGATCACATCCGGGTTTGGCCGTAAAAATTGGTAGCAGGATCTGATAATGAAAAAAATTGAAGCGATTATTAAGCCGTTCAAACT