Homologs in group_588

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01055 FBDBKF_01055 95.2 Morganella morganii S1 ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
EHELCC_00490 EHELCC_00490 95.2 Morganella morganii S2 ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
NLDBIP_02970 NLDBIP_02970 95.2 Morganella morganii S4 ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
LHKJJB_04485 LHKJJB_04485 95.2 Morganella morganii S3 ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
HKOGLL_02560 HKOGLL_02560 95.2 Morganella morganii S5 ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
PMI_RS09105 PMI_RS09105 91.7 Proteus mirabilis HI4320 ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase

Distribution of the homologs in the orthogroup group_588

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_588

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZT3 0.0 696 91 0 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Proteus mirabilis (strain HI4320)
P72241 0.0 691 91 0 362 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Providencia stuartii
Q7N706 0.0 690 89 0 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GHW5 0.0 689 89 0 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Serratia proteamaculans (strain 568)
Q6D276 0.0 687 89 0 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JKS2 0.0 686 88 0 374 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DBH4 0.0 680 87 0 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B1JS05 0.0 677 88 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667Z9 0.0 677 88 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CK91 0.0 677 88 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pestis bv. Antiqua (strain Nepal516)
A9R802 0.0 677 88 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pestis bv. Antiqua (strain Angola)
P58672 0.0 677 88 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pestis
B2K9Q0 0.0 677 88 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5I8 0.0 677 88 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFY9 0.0 677 88 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TMT7 0.0 676 87 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Yersinia pestis (strain Pestoides F)
B2VE89 0.0 669 87 0 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NS40 0.0 664 86 0 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Sodalis glossinidius (strain morsitans)
A7MGV7 0.0 662 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Cronobacter sakazakii (strain ATCC BAA-894)
Q87S16 0.0 660 85 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7LKC3 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R8L8 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli (strain UTI89 / UPEC)
B6I587 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli (strain SE11)
P62620 0.0 660 86 1 373 1 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli (strain K12)
B1IWE6 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P62621 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEX0 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE53 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O1:K1 / APEC
B1XAZ0 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli (strain K12 / DH10B)
C4ZX90 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli (strain K12 / MC4100 / BW2952)
B7MYF0 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O81 (strain ED1a)
B7NRG5 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0Y4 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O157:H7 (strain EC4115 / EHEC)
P62622 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O157:H7
B7LDA7 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli (strain 55989 / EAEC)
B7MI00 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UGW1 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZPV8 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32D47 0.0 660 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shigella dysenteriae serotype 1 (strain Sd197)
B1LNH0 0.0 659 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli (strain SMS-3-5 / SECEC)
B5FAX2 0.0 659 84 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Aliivibrio fischeri (strain MJ11)
Q3YZ37 0.0 659 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shigella sonnei (strain Ss046)
Q31XX5 0.0 659 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shigella boydii serotype 4 (strain Sb227)
B7N6A3 0.0 659 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8A321 0.0 659 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O9:H4 (strain HS)
A6TCD4 0.0 658 86 1 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TR95 0.0 658 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella schwarzengrund (strain CVM19633)
B7M7L9 0.0 658 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Escherichia coli O8 (strain IAI1)
Q9KTX1 0.0 657 85 0 374 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q83K43 0.0 657 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shigella flexneri
Q0T204 0.0 657 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shigella flexneri serotype 5b (strain 8401)
A9MHL5 0.0 657 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4WD93 0.0 657 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Enterobacter sp. (strain 638)
B5F198 0.0 657 86 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella agona (strain SL483)
B5XNL5 0.0 657 86 1 369 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Klebsiella pneumoniae (strain 342)
Q5E772 0.0 657 84 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MNF1 0.0 656 85 0 370 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Vibrio vulnificus (strain YJ016)
Q8DEZ8 0.0 656 85 0 370 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Vibrio vulnificus (strain CMCP6)
P58671 0.0 656 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BAY5 0.0 656 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella paratyphi A (strain AKU_12601)
Q5PNI2 0.0 656 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0P9 0.0 656 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella newport (strain SL254)
B4TD93 0.0 656 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella heidelberg (strain SL476)
B5R582 0.0 656 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella enteritidis PT4 (strain P125109)
B5FR63 0.0 656 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella dublin (strain CT_02021853)
Q57LI6 0.0 656 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella choleraesuis (strain SC-B67)
Q6LU49 0.0 656 84 0 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Photobacterium profundum (strain SS9)
B5RCZ2 0.0 655 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella gallinarum (strain 287/91 / NCTC 13346)
P58670 0.0 655 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella typhi
A8AD71 0.0 654 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7VJT8 0.0 654 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Vibrio atlanticus (strain LGP32)
B2TXU0 0.0 654 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9N201 0.0 653 85 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A7MU42 0.0 651 84 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Vibrio campbellii (strain ATCC BAA-1116)
B6EGY7 0.0 649 83 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Aliivibrio salmonicida (strain LFI1238)
B4RV89 0.0 637 83 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A8H245 0.0 630 83 0 360 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
P57987 0.0 629 83 0 366 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pasteurella multocida (strain Pm70)
Q7VME2 0.0 627 83 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0TLI4 0.0 626 83 0 360 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella halifaxensis (strain HAW-EB4)
P44667 0.0 625 83 1 367 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UGH1 0.0 625 83 1 367 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Haemophilus influenzae (strain PittGG)
B8CKR1 0.0 624 83 0 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella piezotolerans (strain WP3 / JCM 13877)
C4K4I8 0.0 624 82 1 369 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q4QNH4 0.0 623 83 0 360 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Haemophilus influenzae (strain 86-028NP)
Q65R84 0.0 622 84 0 360 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0BQB9 0.0 622 83 1 365 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GY64 0.0 622 83 1 365 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N1H8 0.0 622 83 1 365 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0USG8 0.0 622 82 1 367 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Histophilus somni (strain 2336)
Q0I2E9 0.0 622 82 1 367 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Histophilus somni (strain 129Pt)
A8FT70 0.0 621 80 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella sediminis (strain HAW-EB3)
A3QCG2 0.0 620 82 0 361 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q12PT4 0.0 620 79 1 369 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8EC32 0.0 620 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9KXK8 0.0 620 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella baltica (strain OS195)
A6WQP7 0.0 620 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella baltica (strain OS185)
A3D6V9 0.0 620 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E9S7 0.0 620 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella baltica (strain OS223)
A1S863 0.0 619 81 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A1RHQ3 0.0 618 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella sp. (strain W3-18-1)
Q0HX57 0.0 618 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella sp. (strain MR-7)
Q0HKV9 0.0 618 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella sp. (strain MR-4)
A0KUJ5 0.0 618 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella sp. (strain ANA-3)
A4Y8U0 0.0 618 80 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q085U6 0.0 617 81 1 368 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella frigidimarina (strain NCIMB 400)
A6VQX6 0.0 616 81 1 366 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B1KKJ2 0.0 615 78 1 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shewanella woodyi (strain ATCC 51908 / MS32)
Q47WC0 0.0 602 78 1 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q1LU77 0.0 593 78 1 366 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Baumannia cicadellinicola subsp. Homalodisca coagulata
Q3ICZ5 0.0 587 76 0 372 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudoalteromonas translucida (strain TAC 125)
A1SU39 0.0 583 77 0 366 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q5QYA9 0.0 580 77 0 363 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A5UAB9 0.0 572 84 1 328 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Haemophilus influenzae (strain PittEE)
Q492E0 0.0 546 70 2 367 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Blochmanniella pennsylvanica (strain BPEN)
Q1QTK8 0.0 541 73 1 356 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A6V0W0 0.0 528 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas aeruginosa (strain PA7)
Q9HXJ4 0.0 527 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RV7 0.0 527 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UWI8 0.0 527 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas aeruginosa (strain LESB58)
Q886Z0 0.0 524 72 2 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4K6U9 0.0 522 72 2 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K7B6 0.0 521 72 2 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas fluorescens (strain Pf0-1)
B0KPI7 0.0 521 72 2 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas putida (strain GB-1)
B1JDV8 0.0 520 72 2 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas putida (strain W619)
A4XY32 0.0 520 71 1 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas mendocina (strain ymp)
Q48LZ4 0.0 520 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B3PDM1 0.0 519 70 1 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Cellvibrio japonicus (strain Ueda107)
C1DE57 0.0 519 70 1 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1TZQ0 0.0 518 70 1 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q88PJ7 0.0 516 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VYT5 0.0 516 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1IEI1 0.0 516 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas entomophila (strain L48)
Q4ZX23 0.0 515 72 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas syringae pv. syringae (strain B728a)
Q2SDW4 0.0 514 68 1 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Hahella chejuensis (strain KCTC 2396)
C3K1L4 0.0 513 71 2 356 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudomonas fluorescens (strain SBW25)
A6VV06 0.0 513 67 1 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Marinomonas sp. (strain MWYL1)
P57374 0.0 513 66 1 361 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9P4 0.0 510 65 0 366 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B5EJF3 0.0 510 70 1 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JC30 0.0 510 70 1 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q21KT3 3.45e-180 507 67 1 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8D1Y3 1.06e-173 491 63 1 365 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Wigglesworthia glossinidia brevipalpis
A1AW46 9.41e-173 488 65 2 350 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ruthia magnifica subsp. Calyptogena magnifica
Q6FEM3 1.35e-169 481 66 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0V5G7 1.31e-168 478 64 1 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acinetobacter baumannii (strain AYE)
A3M211 1.31e-168 478 64 1 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VKR8 1.31e-168 478 64 1 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acinetobacter baumannii (strain SDF)
B2I3E5 1.31e-168 478 64 1 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acinetobacter baumannii (strain ACICU)
B7I5G7 1.31e-168 478 64 1 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acinetobacter baumannii (strain AB0057)
B7H069 1.31e-168 478 64 1 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acinetobacter baumannii (strain AB307-0294)
Q0VNE0 1.5e-165 470 63 1 356 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A5CX35 8.81e-165 468 62 2 348 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q1QD18 7.88e-154 441 63 2 363 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FTW7 7.88e-154 441 63 2 363 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A0LDN3 1.78e-144 417 59 2 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q9A9W0 1.07e-140 407 57 0 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A9HJ48 4.07e-138 401 58 2 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q1GIC1 1.4e-137 399 58 0 350 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ruegeria sp. (strain TM1040)
Q28R10 2.08e-137 399 57 0 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Jannaschia sp. (strain CCS1)
Q0C4J3 3.23e-136 396 56 0 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Hyphomonas neptunium (strain ATCC 15444)
Q5FUR7 6.56e-136 395 59 2 344 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Gluconobacter oxydans (strain 621H)
Q4FNA0 1.54e-134 391 54 2 357 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pelagibacter ubique (strain HTCC1062)
A5FX97 3.34e-134 391 60 2 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acidiphilium cryptum (strain JF-5)
Q0BUK0 5.84e-134 390 57 0 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q2RWE4 6.85e-133 388 57 2 356 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A8LI72 3.74e-131 383 58 0 350 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q5NR50 4.1e-131 383 56 2 344 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q74D60 5.64e-130 379 54 2 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q67PA7 1.95e-128 376 51 1 360 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A1B323 1.06e-127 374 58 0 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Paracoccus denitrificans (strain Pd 1222)
Q5LQ99 1.42e-127 374 58 0 350 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B5YIQ4 7e-121 356 49 1 348 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
P58667 3.17e-119 352 50 1 343 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Clostridium perfringens (strain 13 / Type A)
Q1MSE5 1.05e-118 351 50 1 342 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Lawsonia intracellularis (strain PHE/MN1-00)
Q97I56 7.63e-118 348 50 1 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8RA30 7.92e-118 348 53 1 328 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7GSX5 8.02e-117 346 49 1 356 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7IYD0 4.84e-116 344 49 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain G9842)
Q8RG40 5.41e-116 344 48 1 344 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A9VH61 6.99e-116 344 49 1 353 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus mycoides (strain KBAB4)
Q818H8 1.58e-115 343 49 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCQ3 1.58e-115 343 49 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain B4264)
B7HPH8 3.08e-115 342 49 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain AH187)
B9IY45 3.58e-115 342 49 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain Q1)
Q730Q8 3.58e-115 342 49 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9KD18 3.91e-115 342 49 2 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q895K3 8.3e-115 340 47 2 348 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Clostridium tetani (strain Massachusetts / E88)
A4IQZ4 8.47e-115 342 49 1 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Geobacillus thermodenitrificans (strain NG80-2)
C5D4Q3 8.63e-115 341 49 1 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Geobacillus sp. (strain WCH70)
Q6HDN9 1.12e-114 341 48 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1ES01 1.12e-114 341 48 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain 03BB102)
B7JN03 1.12e-114 341 48 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain AH820)
A0RIQ2 1.12e-114 341 48 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus thuringiensis (strain Al Hakam)
C3LKV7 1.12e-114 341 48 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8I5 1.12e-114 341 48 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus anthracis (strain A0248)
Q81LV7 1.28e-114 341 48 1 352 1 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus anthracis
B7GH89 1.42e-114 340 48 1 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q634Q9 1.68e-114 341 48 1 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus cereus (strain ZK / E33L)
B1HSS4 3.64e-114 340 48 2 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Lysinibacillus sphaericus (strain C3-41)
B8I6E1 6.44e-114 338 48 1 346 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q6AP32 1.98e-113 338 48 1 335 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q5KX35 3.65e-113 337 48 1 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Geobacillus kaustophilus (strain HTA426)
Q5WHB2 6.57e-113 336 50 3 348 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Shouchella clausii (strain KSM-K16)
C6BYK9 1.57e-112 335 50 0 327 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A8FF87 2.35e-112 335 49 3 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus pumilus (strain SAFR-032)
A7Z6S2 2.59e-112 335 49 3 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q71ZM9 2.98e-112 335 49 2 345 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Listeria monocytogenes serotype 4b (strain F2365)
C1L2Z7 5.85e-112 334 49 2 345 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Listeria monocytogenes serotype 4b (strain CLIP80459)
P58668 7.43e-112 333 49 2 345 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B9E6U1 9.44e-112 333 48 2 348 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Macrococcus caseolyticus (strain JCSC5402)
P54482 9.54e-112 334 48 2 350 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus subtilis (strain 168)
C4L3K5 1.56e-111 333 49 2 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q65HA9 1.85e-111 333 49 3 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q72CD9 3.79e-111 332 51 0 327 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A4XLZ4 2.06e-108 324 48 1 309 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B1YLA2 5.3e-108 324 47 2 351 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A6Q1U2 1.52e-107 322 51 2 318 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Nitratiruptor sp. (strain SB155-2)
C0ZF58 2.74e-107 322 46 2 349 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q30TM4 9.17e-107 320 49 3 351 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A5FS85 9.58e-107 320 48 1 327 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q8G7Y6 2.99e-106 321 44 3 371 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bifidobacterium longum (strain NCC 2705)
B2V7Y2 3.07e-106 319 44 1 348 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Sulfurihydrogenibium sp. (strain YO3AOP1)
Q3ZZC9 3.69e-106 318 48 1 327 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Dehalococcoides mccartyi (strain CBDB1)
B2A390 7.16e-106 318 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q82K43 1.96e-105 318 47 1 327 3 ispG1 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
C0QRI5 1.18e-104 315 46 1 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Persephonella marina (strain DSM 14350 / EX-H1)
A6QC65 1.22e-104 315 50 2 317 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Sulfurovum sp. (strain NBC37-1)
Q47RY0 4.62e-103 312 47 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermobifida fusca (strain YX)
Q9KYR9 1.52e-102 310 46 1 327 3 ispG2 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9X7W2 1.9e-102 310 46 1 327 3 ispG1 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A1R501 2.53e-102 310 47 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Paenarthrobacter aurescens (strain TC1)
B8HG44 4.22e-102 310 47 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A8L6E2 5.26e-102 309 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Parafrankia sp. (strain EAN1pec)
O67496 5.91e-102 308 45 1 348 1 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Aquifex aeolicus (strain VF5)
Q82ML3 1.01e-101 308 46 1 327 3 ispG2 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A0JUS8 1.65e-101 308 47 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Arthrobacter sp. (strain FB24)
Q5YS74 2.11e-101 308 47 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Nocardia farcinica (strain IFM 10152)
Q6A7L2 2.55e-101 307 47 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Cutibacterium acnes (strain DSM 16379 / KPA171202)
B1VGA4 6.1e-101 306 48 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B9LA27 1.72e-100 304 49 2 318 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A8M723 4.14e-100 305 47 1 327 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salinispora arenicola (strain CNS-205)
B5Z6Z7 1.22e-99 302 47 3 321 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Helicobacter pylori (strain G27)
Q6NGL3 1.44e-99 303 47 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q1CTP7 1.52e-99 302 47 3 321 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Helicobacter pylori (strain HPAG1)
O25342 1.77e-99 302 47 3 321 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Helicobacter pylori (strain ATCC 700392 / 26695)
A9WR14 2.29e-99 303 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
B6JLL3 3e-99 301 47 3 321 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Helicobacter pylori (strain P12)
A5CT01 4.75e-99 301 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
B2UTK0 9.29e-99 300 47 3 321 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Helicobacter pylori (strain Shi470)
Q9ZLL0 9.7e-99 300 47 3 321 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Helicobacter pylori (strain J99 / ATCC 700824)
B1VYP5 1.54e-98 300 45 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A0LV34 1.65e-98 300 47 2 333 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
B0RDZ5 1.8e-98 300 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Clavibacter sepedonicus
Q8NP12 5.9e-98 298 46 2 327 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FP82 6.43e-98 298 46 2 327 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B2GKS3 9.18e-98 298 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
C1B2V4 1.16e-97 298 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhodococcus opacus (strain B4)
Q0RDR2 1.24e-97 298 47 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q4JV28 1.36e-97 298 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Corynebacterium jeikeium (strain K411)
Q6AEX9 1.6e-97 298 45 1 331 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leifsonia xyli subsp. xyli (strain CTCB07)
P9WKG3 2.03e-97 298 46 1 326 1 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKG2 2.03e-97 298 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6M2 2.03e-97 298 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AFY4 2.03e-97 298 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KML3 2.03e-97 298 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TXN6 2.05e-97 298 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A4X4L9 2.11e-97 298 46 1 323 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q83N18 6.12e-97 296 45 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Tropheryma whipplei (strain Twist)
Q83NE4 6.12e-97 296 45 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Tropheryma whipplei (strain TW08/27)
Q2J717 5.44e-96 294 46 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q7VI04 1.37e-95 291 47 2 315 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B4U9V3 1.83e-95 291 43 1 343 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Hydrogenobaculum sp. (strain Y04AAS1)
Q73VS3 1.66e-93 288 45 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
B7IFY1 2.96e-93 285 43 3 318 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermosipho africanus (strain TCF52B)
A8F4Y8 1.03e-92 284 43 3 322 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q17XU2 1.77e-92 284 47 3 321 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Helicobacter acinonychis (strain Sheeba)
Q9CBU5 5.18e-90 279 45 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycobacterium leprae (strain TN)
B8ZRU5 5.18e-90 279 45 1 326 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycobacterium leprae (strain Br4923)
Q8EUI6 2.41e-89 276 40 2 348 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Malacoplasma penetrans (strain HF-2)
B1LC43 7.59e-88 271 43 5 341 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermotoga sp. (strain RQ2)
A5IIP2 7.59e-88 271 43 5 341 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WZZ3 3.57e-87 270 43 5 341 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A7H4D8 4.44e-87 270 40 3 346 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FLB6 2.06e-86 268 40 3 346 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1VZ41 3.36e-86 268 40 3 346 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PPM1 3.4e-86 268 40 3 346 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HV95 5.35e-86 267 40 3 346 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter jejuni (strain RM1221)
Q7M8Z2 2.7e-85 266 46 2 314 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B9KD64 4.71e-85 265 40 3 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q7NBH3 1.41e-84 264 38 2 356 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
A7GZ54 3.67e-84 262 43 3 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter curvus (strain 525.92)
A7ZCT9 4.55e-84 262 43 3 347 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter concisus (strain 13826)
A0RPL8 1.09e-79 251 39 3 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Campylobacter fetus subsp. fetus (strain 82-40)
B0C6E1 6.93e-76 243 37 8 390 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Acaryochloris marina (strain MBIC 11017)
B7KJJ4 4.48e-75 241 37 8 391 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Gloeothece citriformis (strain PCC 7424)
P73672 6.07e-75 240 37 8 391 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1WQF1 1.79e-74 239 36 8 391 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Crocosphaera subtropica (strain ATCC 51142 / BH68)
B2J1G1 1.32e-73 237 39 9 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q10W70 1.38e-73 237 38 9 359 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Trichodesmium erythraeum (strain IMS101)
P58666 3.75e-73 236 39 8 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B0JJJ8 4.44e-73 236 37 9 388 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B1XHZ7 5.63e-73 235 38 8 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3MG27 6.48e-73 235 39 8 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q7V215 1.52e-72 234 38 9 382 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B7K5R5 1.81e-72 234 38 8 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Rippkaea orientalis (strain PCC 8801 / RF-1)
B8HSI6 3.51e-72 233 36 8 392 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q3AK30 5.38e-72 233 40 9 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Synechococcus sp. (strain CC9605)
Q2JS69 1.04e-71 232 40 10 354 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Synechococcus sp. (strain JA-3-3Ab)
Q8DK70 1.14e-71 232 38 8 355 1 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q73N90 1.33e-71 231 38 4 361 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7VBS7 1.57e-71 232 38 8 349 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q0I9J4 2.29e-71 231 40 10 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Synechococcus sp. (strain CC9311)
Q3AXP3 2.89e-71 231 40 8 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Synechococcus sp. (strain CC9902)
O83460 6.65e-71 230 40 3 330 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Treponema pallidum (strain Nichols)
Q2JPZ9 1.84e-69 226 37 10 393 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Synechococcus sp. (strain JA-2-3B'a(2-13))
Q7U712 2.65e-69 226 39 9 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Parasynechococcus marenigrum (strain WH8102)
Q5N3W3 3.72e-69 226 38 8 349 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31QC4 3.72e-69 226 38 8 349 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7V7G9 3.9e-65 215 38 8 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Prochlorococcus marinus (strain MIT 9313)
Q7NFA4 4.89e-65 214 37 8 345 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q604Q5 6.25e-60 201 35 10 378 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9RXC9 9.77e-60 202 35 11 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q1IRS5 2.86e-59 200 37 12 376 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Koribacter versatilis (strain Ellin345)
Q6G1X4 9.29e-59 199 34 11 397 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A9IYW1 1.39e-58 198 35 10 364 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q1H0U9 2.58e-58 198 37 14 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4YKQ8 2.91e-58 198 34 12 382 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bradyrhizobium sp. (strain ORS 278)
A5ETI5 3.1e-58 198 34 12 382 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q7UWC8 4.48e-58 196 38 11 338 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q04UL2 5.25e-58 202 41 6 280 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q04UL2 3.28e-13 74 37 3 106 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B6JA27 5.94e-58 197 36 15 386 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q6G104 6.08e-58 196 36 11 364 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bartonella quintana (strain Toulouse)
Q04YW2 6.19e-58 202 41 6 280 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04YW2 3.4e-13 74 37 3 106 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q84GJ3 3.89e-57 194 37 11 372 1 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermus thermophilus
Q72H18 3.89e-57 194 37 11 372 1 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q72TR2 6.33e-57 199 41 7 283 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q72TR2 1.63e-14 78 39 3 106 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F1H5 6.81e-57 199 41 7 282 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8F1H5 1.79e-14 78 39 3 106 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q5SLI8 2.57e-56 192 37 11 372 1 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B2FL74 5e-56 192 35 9 374 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Stenotrophomonas maltophilia (strain K279a)
Q89VV9 5.47e-56 192 33 10 377 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B4RMG4 8.49e-56 191 34 12 376 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Neisseria gonorrhoeae (strain NCCP11945)
Q5F913 8.49e-56 191 34 12 376 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JU34 1.31e-55 191 34 11 376 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9LZN8 1.31e-55 191 34 11 376 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Neisseria meningitidis serogroup C (strain 053442)
Q5P7B3 1.34e-55 191 35 11 378 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1KUD8 1.73e-55 190 34 11 376 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JZ40 2.11e-55 190 34 11 376 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B0B9G5 3.39e-55 194 42 7 280 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
B0B9G5 9.69e-10 63 34 0 75 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q9PKY3 3.82e-55 194 42 8 281 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia muridarum (strain MoPn / Nigg)
Q9PKY3 4.46e-10 64 36 0 75 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia muridarum (strain MoPn / Nigg)
O84060 5.13e-55 193 42 7 280 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
O84060 6.91e-10 64 34 0 75 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3SVD0 5.17e-55 189 34 12 382 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B0BB44 6.11e-55 193 42 7 280 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0BB44 9.78e-10 63 34 0 75 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q3KMW4 6.31e-55 193 42 7 280 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q3KMW4 6.97e-10 64 34 0 75 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q6NCF3 1.13e-54 189 34 13 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B3QBC6 1.13e-54 188 34 12 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhodopseudomonas palustris (strain TIE-1)
B2SG03 1.3e-54 187 35 9 353 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2J2S7 1.57e-54 188 34 13 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhodopseudomonas palustris (strain HaA2)
Q0AE42 1.7e-54 187 36 9 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B2IE63 1.88e-54 188 35 12 373 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q63UT3 2.4e-54 187 36 12 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia pseudomallei (strain K96243)
A3NVX1 2.4e-54 187 36 12 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia pseudomallei (strain 1106a)
A1V4K1 2.4e-54 187 36 12 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia mallei (strain SAVP1)
A2S2A2 2.4e-54 187 36 12 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia mallei (strain NCTC 10229)
A3MK75 2.4e-54 187 36 12 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia mallei (strain NCTC 10247)
B4SRZ0 2.45e-54 187 34 10 374 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Stenotrophomonas maltophilia (strain R551-3)
A3NA54 2.48e-54 187 36 12 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia pseudomallei (strain 668)
P58669 2.5e-54 187 35 11 382 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3JRQ3 3.2e-54 187 36 12 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia pseudomallei (strain 1710b)
Q62JW4 3.2e-54 187 36 12 352 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia mallei (strain ATCC 23344)
Q0BMA6 4.18e-54 186 34 9 353 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Francisella tularensis subsp. holarctica (strain OSU18)
Q1QQI9 4.23e-54 187 33 10 361 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q21C20 8.64e-54 186 34 14 386 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhodopseudomonas palustris (strain BisB18)
A1UR54 1.31e-53 185 37 10 362 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B2U9U9 1.88e-53 185 36 13 387 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ralstonia pickettii (strain 12J)
Q5NH64 2.86e-53 184 34 9 353 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14IL6 2.86e-53 184 34 9 353 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Francisella tularensis subsp. tularensis (strain FSC 198)
B4EAW9 3.46e-53 185 36 10 346 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0Q6U8 3.5e-53 184 34 9 353 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Francisella tularensis subsp. novicida (strain U112)
Q2P3M7 3.54e-53 184 35 13 371 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q47BR6 4.6e-53 184 34 13 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Dechloromonas aromatica (strain RCB)
Q5H0N8 9.54e-53 183 35 13 371 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q9PAE3 1.61e-52 182 34 10 363 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xylella fastidiosa (strain 9a5c)
Q8P9R7 2.19e-52 182 34 14 396 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RTS9 2.19e-52 182 34 14 396 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xanthomonas campestris pv. campestris (strain B100)
Q4UTW8 2.19e-52 182 34 14 396 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xanthomonas campestris pv. campestris (strain 8004)
Q7W6P6 2.4e-52 182 35 12 361 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHN0 2.4e-52 182 35 12 361 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VWL0 3.12e-52 182 35 13 379 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7NS88 3.63e-52 182 35 13 385 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
C3MAL6 1.24e-51 180 35 11 377 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3BUK3 1.66e-51 180 35 13 371 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q82XV0 2.03e-51 179 35 10 361 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q87A73 2.12e-51 179 34 10 363 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8PLJ8 2.72e-51 179 35 13 371 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Xanthomonas axonopodis pv. citri (strain 306)
Q07V91 4.08e-51 179 33 13 384 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhodopseudomonas palustris (strain BisA53)
A6WXY9 5.12e-51 179 34 11 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8YJ17 6.23e-51 178 34 11 379 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RF32 6.23e-51 178 34 11 379 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella melitensis biotype 2 (strain ATCC 23457)
Q57BA5 6.3e-51 178 34 11 379 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella abortus biovar 1 (strain 9-941)
Q2YLG4 6.3e-51 178 34 11 379 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella abortus (strain 2308)
B2S7K6 6.3e-51 178 34 11 379 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella abortus (strain S19)
Q8FYT2 6.37e-51 178 34 11 379 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella suis biovar 1 (strain 1330)
A9M820 1.11e-50 177 34 10 363 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
B1YR44 1.19e-50 178 36 10 346 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Burkholderia ambifaria (strain MC40-6)
A9WWQ2 1.37e-50 177 34 11 379 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Brucella suis (strain ATCC 23445 / NCTC 10510)
B3PR71 1.47e-49 175 34 12 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhizobium etli (strain CIAT 652)
Q6MD85 4.04e-49 178 41 7 272 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Protochlamydia amoebophila (strain UWE25)
Q6MD85 2.89e-13 74 27 2 169 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Protochlamydia amoebophila (strain UWE25)
Q6K8J4 5.33e-49 179 39 5 273 2 ISPG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic Oryza sativa subsp. japonica
Q6K8J4 5.03e-09 61 30 2 107 2 ISPG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic Oryza sativa subsp. japonica
Q254D2 6.1e-49 177 39 6 292 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia felis (strain Fe/C-56)
Q254D2 2.49e-10 65 30 3 128 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia felis (strain Fe/C-56)
Q8KG23 8.31e-49 178 39 7 282 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8KG23 1.22e-17 88 32 3 165 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q029T9 9.42e-49 172 37 13 358 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Solibacter usitatus (strain Ellin6076)
Q5L669 1.75e-48 176 38 5 280 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia abortus (strain DSM 27085 / S26/3)
Q5L669 3.35e-11 68 32 2 111 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia abortus (strain DSM 27085 / S26/3)
Q823I7 1.99e-48 176 38 5 280 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q823I7 7.65e-10 63 31 2 111 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q2K333 5.15e-48 171 33 11 377 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
F4K0E8 1.25e-47 175 39 6 272 1 ISPG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic Arabidopsis thaliana
F4K0E8 2.04e-07 56 30 2 100 1 ISPG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic Arabidopsis thaliana
Q9Z8H0 2.08e-47 173 39 5 285 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia pneumoniae
Q9Z8H0 1.08e-11 69 32 2 111 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Chlamydia pneumoniae
A6UE79 2.28e-47 169 34 10 336 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Sinorhizobium medicae (strain WSM419)
Q92L19 1.91e-46 166 34 12 341 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhizobium meliloti (strain 1021)
Q98FG0 4.59e-46 166 35 12 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1MAC5 5.6e-46 165 32 12 353 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B5ZUA0 7.27e-46 165 32 12 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B9JV07 2.42e-45 164 32 12 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
P58665 2.6e-45 163 32 12 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5PAJ1 3.26e-45 163 32 13 376 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Anaplasma marginale (strain St. Maries)
B9JE02 3.71e-45 163 31 11 355 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q7MVT7 8.21e-45 165 36 6 302 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q7MVT7 3.61e-09 62 33 3 110 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A6L089 9.1e-45 166 37 7 292 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A6L089 8.58e-09 60 32 3 109 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q3YRZ7 1.86e-44 161 31 12 380 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ehrlichia canis (strain Jake)
C1DD43 4.24e-44 160 34 13 387 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Laribacter hongkongensis (strain HLHK9)
Q8A4T0 4.3e-44 164 36 6 285 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A4T0 8.42e-09 60 28 4 142 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q73IP1 2.91e-43 158 31 9 388 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Wolbachia pipientis wMel
Q5GRK4 4.58e-43 158 30 10 407 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q5HB57 5.29e-43 157 31 15 401 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ehrlichia ruminantium (strain Welgevonden)
Q5FHA6 6.32e-43 157 31 15 401 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Ehrlichia ruminantium (strain Gardel)
A6LGR5 6.51e-43 160 35 9 330 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A6LGR5 1.63e-10 66 34 2 107 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
C0R5E5 8.4e-43 157 31 9 388 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Wolbachia sp. subsp. Drosophila simulans (strain wRi)
B2UKT9 9.49e-43 160 36 6 278 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B2UKT9 2.93e-12 71 28 4 190 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q5L7W2 1.25e-42 160 35 7 308 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5L7W2 4.97e-08 58 24 3 153 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64N34 2.18e-42 159 35 7 308 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacteroides fragilis (strain YCH46)
Q64N34 3.42e-08 58 25 3 153 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Bacteroides fragilis (strain YCH46)
B3CNN4 3.36e-40 150 29 9 391 3 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) Wolbachia pipientis subsp. Culex pipiens (strain wPip)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07130
Feature type CDS
Gene ispG
Product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
Location 1480414 - 1481538 (strand: -1)
Length 1125 (nucleotides) / 374 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_588
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04551 GcpE protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0821 Lipid transport and metabolism (I) I 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase IspG/GcpE

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03526 (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase [EC:1.17.7.1 1.17.7.3] Terpenoid backbone biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
C5 isoprenoid biosynthesis, non-mevalonate pathway

Protein Sequence

MHSESPIKRRKSTRIYVGNVPVGDGAPITVQSMTNTRTTDVDATVRQIKALERVGVDIVRVSVPTMDAAEAFKLIKQQVSVPLVADIHFDYRIALKVAEYGVDCLRINPGNIGSEERVRQVVDCARHYNIPIRIGVNGGSLEKDIQEKYGEPTPEALVESAMRHVDILDRLNFDQFKISVKASDVFLAVGAYRLLANKIDQPLHLGITEAGGARAGSVKSAIGLGLLLSEGIGDTLRISLAADPVEEVKVGFDILKSLRIRARGINFIACPTCSRQEFDVIGTVNALEQRLEDILTPMDISIIGCVVNGPGEAEVSTLGVTGAKTRSGFYEDGVRQKERLDNTDMIDQLEAKIRAKAAMLDKNNRIAINLVDKE

Flanking regions ( +/- flanking 50bp)

AATTAACACAGCAATGATTGAGGATACAGGGATGTTCCGGAGAAATAATTATGCACAGTGAATCCCCGATAAAGAGACGCAAATCCACCCGGATTTATGTGGGTAATGTGCCGGTCGGTGATGGCGCACCTATTACGGTGCAGTCAATGACAAACACCCGGACAACGGATGTTGACGCGACAGTTCGTCAGATTAAAGCGCTGGAGCGCGTCGGTGTTGATATCGTCCGTGTTTCTGTGCCGACAATGGATGCGGCAGAAGCCTTTAAGTTAATTAAACAGCAGGTTTCTGTGCCGCTGGTGGCAGATATTCATTTTGATTACCGTATCGCGCTGAAAGTGGCGGAATACGGTGTGGATTGTCTGCGGATAAACCCGGGGAATATCGGCAGCGAAGAGCGCGTCCGTCAGGTCGTGGATTGCGCACGCCATTACAATATCCCTATCCGTATCGGGGTTAACGGCGGATCACTGGAAAAAGATATTCAGGAAAAATACGGCGAGCCGACACCGGAAGCGCTGGTGGAATCCGCCATGCGTCATGTGGATATTCTCGATCGCCTGAATTTCGATCAGTTCAAAATCAGTGTGAAAGCCTCTGATGTCTTTTTGGCAGTGGGTGCTTACCGGCTGCTGGCGAACAAAATTGACCAGCCGCTGCATCTGGGTATTACAGAAGCGGGTGGTGCGCGGGCAGGATCAGTGAAATCTGCTATCGGCCTGGGGTTACTGCTCTCAGAGGGGATTGGCGATACACTGCGGATCTCGCTGGCGGCTGATCCTGTTGAAGAAGTGAAAGTCGGGTTTGATATTCTTAAATCGCTGCGGATACGTGCCCGCGGTATTAATTTTATCGCCTGCCCGACCTGTTCACGCCAGGAATTTGATGTGATTGGCACGGTTAATGCGCTGGAACAACGGCTGGAAGATATTCTGACGCCGATGGACATCTCTATTATCGGCTGTGTGGTCAATGGTCCGGGTGAGGCGGAAGTCTCAACACTGGGTGTGACCGGCGCGAAAACGCGCAGCGGCTTTTATGAAGATGGTGTCCGCCAGAAAGAGCGCCTGGATAATACGGATATGATTGACCAGCTTGAGGCAAAAATTCGCGCCAAAGCGGCAATGCTGGATAAAAATAACCGGATTGCCATTAATCTGGTCGATAAAGAGTAATAACTGACCGGTTCATTGTATAATGAACCGGTTTTAAGACGATATATCGG