Homologs in group_2248

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17210 FBDBKF_17210 86.1 Morganella morganii S1 osmB osmotically-inducible lipoprotein OsmB
EHELCC_01680 EHELCC_01680 86.1 Morganella morganii S2 osmB osmotically-inducible lipoprotein OsmB
NLDBIP_01780 NLDBIP_01780 86.1 Morganella morganii S4 osmB osmotically-inducible lipoprotein OsmB
LHKJJB_00255 LHKJJB_00255 86.1 Morganella morganii S3 osmB osmotically-inducible lipoprotein OsmB
HKOGLL_00295 HKOGLL_00295 86.1 Morganella morganii S5 osmB osmotically-inducible lipoprotein OsmB
PMI_RS06210 PMI_RS06210 61.6 Proteus mirabilis HI4320 osmB osmotically-inducible lipoprotein OsmB

Distribution of the homologs in the orthogroup group_2248

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2248

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ADB0 2.73e-08 48 58 0 72 3 osmB Osmotically-inducible lipoprotein B Shigella flexneri
P0ADA7 2.73e-08 48 58 0 72 2 osmB Osmotically-inducible lipoprotein B Escherichia coli (strain K12)
P0ADA8 2.73e-08 48 58 0 72 3 osmB Osmotically-inducible lipoprotein B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ADA9 2.73e-08 48 58 0 72 3 osmB Osmotically-inducible lipoprotein B Escherichia coli O157:H7
P37723 1.61e-07 46 56 0 72 2 osmB Osmotically-inducible lipoprotein B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05970
Feature type CDS
Gene osmB
Product osmotically-inducible lipoprotein OsmB
Location 1268289 - 1268510 (strand: 1)
Length 222 (nucleotides) / 73 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2248
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF05433 Glycine zipper 2TM domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04062 osmotically inducible lipoprotein OsmB - -

Protein Sequence

MNANTKRVSTVILSAALLLAVAGCSNMSKRDRHTAIGAGVGAVGGAILTDGSALGTVGGAAIGGLIGRQTGKK

Flanking regions ( +/- flanking 50bp)

TGCAAAACAGAACTATGTTGTCATACGCCATTTTCTCAGGAGTTTATAATATGAATGCGAATACCAAAAGAGTAAGCACGGTGATTTTATCTGCAGCTCTGTTGCTTGCTGTTGCCGGCTGTTCAAATATGTCGAAACGCGACCGGCACACCGCAATTGGTGCCGGTGTCGGTGCTGTTGGTGGCGCTATCTTAACTGATGGCAGTGCATTAGGTACTGTTGGTGGCGCGGCAATCGGCGGACTTATCGGTCGTCAGACAGGAAAAAAATAATTTACCGGAGCCGGTATCATGCCGGCTCCCTGCCTTACCCGGCTTTCGTG