Homologs in group_329

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09920 FBDBKF_09920 27.7 Morganella morganii S1 nagB glucosamine-6-phosphate deaminase
EHELCC_04720 EHELCC_04720 27.7 Morganella morganii S2 nagB glucosamine-6-phosphate deaminase
NLDBIP_04720 NLDBIP_04720 27.7 Morganella morganii S4 nagB glucosamine-6-phosphate deaminase
LHKJJB_13910 LHKJJB_13910 27.7 Morganella morganii S3 nagB glucosamine-6-phosphate deaminase
HKOGLL_12625 HKOGLL_12625 27.7 Morganella morganii S5 nagB glucosamine-6-phosphate deaminase
F4V73_RS00430 F4V73_RS00430 26.9 Morganella psychrotolerans nagB glucosamine-6-phosphate deaminase
PMI_RS02275 PMI_RS02275 26.9 Proteus mirabilis HI4320 nagB glucosamine-6-phosphate deaminase

Distribution of the homologs in the orthogroup group_329

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_329

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B7IWG6 9.82e-37 133 38 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain G9842)
Q819D1 1.86e-36 132 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H945 1.86e-36 132 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain B4264)
Q6HEB2 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q635M6 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain ZK / E33L)
B9IWR7 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain Q1)
B7HN32 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain AH187)
C1EQS8 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain 03BB102)
Q731P4 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JL33 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cereus (strain AH820)
Q81MH5 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus anthracis
A0RI59 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus thuringiensis (strain Al Hakam)
C3LIR9 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P761 1.04e-35 130 37 3 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus anthracis (strain A0248)
A9VFF7 5.15e-35 129 35 3 186 3 nagB Glucosamine-6-phosphate deaminase Bacillus mycoides (strain KBAB4)
P65515 2.77e-33 124 32 1 188 3 nagB Glucosamine-6-phosphate deaminase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65514 2.77e-33 124 32 1 188 3 nagB Glucosamine-6-phosphate deaminase Streptococcus agalactiae serotype III (strain NEM316)
Q3K1Q7 2.77e-33 124 32 1 188 3 nagB Glucosamine-6-phosphate deaminase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5XBG4 7.57e-33 122 31 4 222 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A7GS78 2.84e-32 122 36 2 174 3 nagB Glucosamine-6-phosphate deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q047I3 4.02e-32 120 31 6 207 3 nagB Glucosamine-6-phosphate deaminase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G817 4.02e-32 120 31 6 207 3 nagB Glucosamine-6-phosphate deaminase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
C5D3L0 4.86e-32 121 32 8 230 3 nagB Glucosamine-6-phosphate deaminase Geobacillus sp. (strain WCH70)
C4L2C5 5.8e-32 120 37 3 188 3 nagB Glucosamine-6-phosphate deaminase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q97MK9 8.12e-32 120 31 4 193 3 nagB Glucosamine-6-phosphate deaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B4U206 9.92e-32 119 30 4 222 3 nagB Glucosamine-6-phosphate deaminase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M970 1.01e-31 119 30 4 222 3 nagB Glucosamine-6-phosphate deaminase Streptococcus equi subsp. equi (strain 4047)
C0MCU1 1.32e-31 119 30 4 222 3 nagB Glucosamine-6-phosphate deaminase Streptococcus equi subsp. zooepidemicus (strain H70)
A8FHS6 2.58e-31 119 31 9 244 3 nagB Glucosamine-6-phosphate deaminase Bacillus pumilus (strain SAFR-032)
P0DC67 3.78e-31 118 32 3 189 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC66 3.78e-31 118 32 3 189 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5HRH8 4.95e-31 118 31 6 219 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A2RDX6 5.25e-31 118 32 3 189 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pyogenes serotype M5 (strain Manfredo)
A3CLX4 5.27e-31 117 29 5 229 3 nagB Glucosamine-6-phosphate deaminase Streptococcus sanguinis (strain SK36)
B5XM45 7.53e-31 117 31 3 189 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pyogenes serotype M49 (strain NZ131)
Q8P0E0 1.5e-30 116 31 3 189 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pyogenes serotype M18 (strain MGAS8232)
B8D185 1.79e-30 116 34 4 192 3 nagB Glucosamine-6-phosphate deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B1YJ30 1.86e-30 117 35 3 189 3 nagB Glucosamine-6-phosphate deaminase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
C1CQU2 2.56e-30 116 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CLC3 2.56e-30 116 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae (strain P1031)
C1CF03 2.56e-30 116 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae (strain JJA)
B8ZKX4 2.56e-30 116 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1ICL5 2.56e-30 116 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae (strain Hungary19A-6)
B5E5S3 2.56e-30 116 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae serotype 19F (strain G54)
Q8CTR3 2.9e-30 116 29 7 224 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q97Q16 2.95e-30 115 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DPA1 4.44e-30 115 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
C1C814 4.44e-30 115 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae (strain 70585)
Q04JT5 4.44e-30 115 30 6 207 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8Y8E7 4.71e-30 115 28 4 230 3 nagB Glucosamine-6-phosphate deaminase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DEH8 4.82e-30 115 28 4 230 3 nagB Glucosamine-6-phosphate deaminase Listeria monocytogenes serotype 4a (strain HCC23)
Q99Z50 5.59e-30 115 31 3 189 3 nagB Glucosamine-6-phosphate deaminase Streptococcus pyogenes serotype M1
Q92D64 7.2e-30 115 28 4 230 3 nagB Glucosamine-6-phosphate deaminase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q74HC4 9.61e-30 114 34 5 175 3 nagB Glucosamine-6-phosphate deaminase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q033M5 1.19e-29 114 31 5 191 3 nagB Glucosamine-6-phosphate deaminase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q721K9 1.25e-29 114 28 4 230 3 nagB Glucosamine-6-phosphate deaminase Listeria monocytogenes serotype 4b (strain F2365)
C1L1M8 1.25e-29 114 28 4 230 3 nagB Glucosamine-6-phosphate deaminase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q88ZS6 2.35e-29 113 31 3 191 3 nagB Glucosamine-6-phosphate deaminase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P59687 3.4e-29 113 26 6 232 3 nagB Glucosamine-6-phosphate deaminase Enterococcus faecalis (strain ATCC 700802 / V583)
Q03H91 7.5e-29 112 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q03Z95 1.66e-28 111 29 6 231 3 nagB Glucosamine-6-phosphate deaminase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B9DWG4 1.91e-28 111 30 3 190 3 nagB Glucosamine-6-phosphate deaminase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
O35000 2.09e-28 111 32 5 198 1 nagB Glucosamine-6-phosphate deaminase 1 Bacillus subtilis (strain 168)
A4VU11 4e-28 110 30 6 210 3 nagB Glucosamine-6-phosphate deaminase Streptococcus suis (strain 05ZYH33)
A4W0A3 4e-28 110 30 6 210 3 nagB Glucosamine-6-phosphate deaminase Streptococcus suis (strain 98HAH33)
B1MX39 5.54e-28 110 32 2 190 3 nagB Glucosamine-6-phosphate deaminase Leuconostoc citreum (strain KM20)
A8MIX7 6.39e-28 110 30 7 237 3 nagB Glucosamine-6-phosphate deaminase Alkaliphilus oremlandii (strain OhILAs)
A0PYW1 7.8e-28 109 28 7 245 3 nagB Glucosamine-6-phosphate deaminase Clostridium novyi (strain NT)
Q1WS60 9.12e-28 109 31 5 190 3 nagB Glucosamine-6-phosphate deaminase Ligilactobacillus salivarius (strain UCC118)
C1FV12 1.04e-27 109 30 4 193 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain Kyoto / Type A2)
C3L2N7 1.04e-27 109 30 4 193 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain 657 / Type Ba4)
Q02Y08 1.23e-27 109 28 4 207 3 nagB Glucosamine-6-phosphate deaminase Lactococcus lactis subsp. cremoris (strain SK11)
A2RJR7 1.23e-27 109 28 4 207 3 nagB Glucosamine-6-phosphate deaminase Lactococcus lactis subsp. cremoris (strain MG1363)
Q8R5T0 1.33e-27 109 27 6 249 3 nagB Glucosamine-6-phosphate deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
O31458 4.11e-27 108 35 7 188 2 gamA Glucosamine-6-phosphate deaminase 2 Bacillus subtilis (strain 168)
Q8DV70 5.4e-27 107 30 4 200 1 nagB Glucosamine-6-phosphate deaminase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O97439 6.16e-27 108 33 5 201 3 GPI1 Glucosamine-6-phosphate isomerase 1 Giardia intestinalis
Q0SQB4 6.41e-27 107 29 6 232 3 nagB Glucosamine-6-phosphate deaminase Clostridium perfringens (strain SM101 / Type A)
Q5FHT1 6.59e-27 107 31 3 176 3 nagB Glucosamine-6-phosphate deaminase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
P59686 6.93e-27 106 30 2 182 2 nagB Glucosamine-6-phosphate deaminase Lysinibacillus sphaericus
Q9CFA8 9.27e-27 107 27 4 207 3 nagB Glucosamine-6-phosphate deaminase Lactococcus lactis subsp. lactis (strain IL1403)
C0ZJF8 1.22e-26 107 31 6 203 3 nagB Glucosamine-6-phosphate deaminase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q8ESL6 1.28e-26 107 29 10 241 3 nagB Glucosamine-6-phosphate deaminase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A0AH75 1.49e-26 106 30 3 178 3 nagB Glucosamine-6-phosphate deaminase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5WHY0 2.89e-26 105 31 5 187 3 nagB Glucosamine-6-phosphate deaminase Shouchella clausii (strain KSM-K16)
A5VKB2 3.63e-26 105 29 4 196 3 nagB Glucosamine-6-phosphate deaminase Limosilactobacillus reuteri (strain DSM 20016)
Q0TML8 4.43e-26 105 29 6 232 3 nagB Glucosamine-6-phosphate deaminase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8XHP8 4.77e-26 105 29 6 232 3 nagB Glucosamine-6-phosphate deaminase Clostridium perfringens (strain 13 / Type A)
A8YTN8 7.16e-26 104 30 5 190 3 nagB Glucosamine-6-phosphate deaminase Lactobacillus helveticus (strain DPC 4571)
B2TL69 8.62e-26 104 29 7 234 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain Eklund 17B / Type B)
B1KZ07 1.01e-25 104 29 4 193 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain Loch Maree / Type A3)
Q04G36 1.29e-25 103 30 5 191 3 nagB Glucosamine-6-phosphate deaminase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A7GH51 1.36e-25 103 29 4 193 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IKY4 1.36e-25 103 29 4 193 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain Okra / Type B1)
O97440 2.44e-25 103 33 5 204 3 GPI2 Glucosamine-6-phosphate isomerase 2 Giardia intestinalis
A5I5R9 3.5e-25 102 29 4 193 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FX73 3.5e-25 102 29 4 193 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain ATCC 19397 / Type A)
A9NEX8 3.57e-25 102 26 7 248 3 nagB Glucosamine-6-phosphate deaminase Acholeplasma laidlawii (strain PG-8A)
B2V163 4.9e-25 102 29 7 234 3 nagB Glucosamine-6-phosphate deaminase Clostridium botulinum (strain Alaska E43 / Type E3)
Q2YS95 5.97e-25 102 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q890L6 6.02e-25 102 29 3 188 3 nagB Glucosamine-6-phosphate deaminase Clostridium tetani (strain Massachusetts / E88)
Q9KFQ8 7.75e-25 102 30 4 185 3 nagB Glucosamine-6-phosphate deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q38YK9 1.25e-24 101 29 5 184 3 nagB Glucosamine-6-phosphate deaminase Latilactobacillus sakei subsp. sakei (strain 23K)
P65513 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain MW2)
A8YZR7 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBR8 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain MSSA476)
P99125 3.55e-24 100 31 5 199 1 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain N315)
P65512 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QEM2 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain Newman)
Q5HIA6 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain COL)
A5IQC3 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain JH9)
Q2G0K8 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ71 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain USA300)
A6TZ46 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain JH1)
A7WZ06 3.55e-24 100 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L9T8 4.04e-24 100 32 4 191 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus haemolyticus (strain JCSC1435)
B1HUU8 5.03e-24 99 30 8 227 3 nagB Glucosamine-6-phosphate deaminase Lysinibacillus sphaericus (strain C3-41)
Q49VB6 5.47e-24 99 29 5 198 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q03LS1 7.46e-24 99 29 4 198 3 nagB Glucosamine-6-phosphate deaminase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A7Z975 7.72e-24 99 29 6 227 3 nagB Glucosamine-6-phosphate deaminase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q6GJA0 1.59e-23 98 31 5 199 3 nagB Glucosamine-6-phosphate deaminase Staphylococcus aureus (strain MRSA252)
A8AYK4 1.97e-23 98 28 5 235 3 nagB Glucosamine-6-phosphate deaminase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q18AL0 2.07e-23 98 29 4 192 3 nagB Glucosamine-6-phosphate deaminase Clostridioides difficile (strain 630)
A6M241 6.33e-23 97 25 7 244 3 nagB Glucosamine-6-phosphate deaminase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q487K8 3.69e-22 95 27 8 254 3 nagB Glucosamine-6-phosphate deaminase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A6TVP5 8.41e-22 94 29 4 191 3 nagB Glucosamine-6-phosphate deaminase Alkaliphilus metalliredigens (strain QYMF)
A7FKU3 1.23e-21 94 29 8 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JG88 1.54e-21 93 28 7 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DC7 1.54e-21 93 28 7 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TNY0 1.54e-21 93 28 7 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pestis (strain Pestoides F)
Q1CKN7 1.54e-21 93 28 7 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7S4 1.54e-21 93 28 7 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDE1 1.54e-21 93 28 7 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pestis
B2K8A2 1.54e-21 93 28 7 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C537 1.54e-21 93 28 7 237 3 nagB Glucosamine-6-phosphate deaminase Yersinia pestis bv. Antiqua (strain Antiqua)
A7N5W3 1.64e-21 93 29 4 192 3 nagB Glucosamine-6-phosphate deaminase Vibrio campbellii (strain ATCC BAA-1116)
Q7UVM5 2.67e-21 92 32 4 184 3 nagB Glucosamine-6-phosphate deaminase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A3QB39 3.14e-21 92 27 6 237 3 nagB Glucosamine-6-phosphate deaminase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A0JY49 4.66e-21 92 31 5 192 3 nagB Glucosamine-6-phosphate deaminase Arthrobacter sp. (strain FB24)
A9KIR8 4.93e-21 91 28 8 222 3 nagB Glucosamine-6-phosphate deaminase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B0K0J7 5.6e-21 92 25 6 235 3 nagB Glucosamine-6-phosphate deaminase Thermoanaerobacter sp. (strain X514)
Q8REG1 1.11e-20 91 28 4 193 3 nagB Glucosamine-6-phosphate deaminase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
C6C0A2 1.88e-20 90 27 5 200 3 nagB Glucosamine-6-phosphate deaminase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q2S6X5 2.27e-20 90 32 7 220 3 nagB Glucosamine-6-phosphate deaminase Hahella chejuensis (strain KCTC 2396)
B0K934 2.42e-20 90 25 6 235 3 nagB Glucosamine-6-phosphate deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B5XZG9 2.44e-20 90 30 5 192 3 nagB Glucosamine-6-phosphate deaminase Klebsiella pneumoniae (strain 342)
A6T6C1 4.16e-20 89 29 5 194 3 nagB Glucosamine-6-phosphate deaminase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A6VVU9 4.96e-20 89 28 6 235 3 nagB Glucosamine-6-phosphate deaminase Marinomonas sp. (strain MWYL1)
Q9CMF4 7.14e-20 89 28 4 202 1 nagB Glucosamine-6-phosphate deaminase Pasteurella multocida (strain Pm70)
Q8Z8G0 8.1e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella typhi
Q8ZQX7 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TPZ8 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella schwarzengrund (strain CVM19633)
B5BCC5 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella paratyphi A (strain AKU_12601)
C0PWA5 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella paratyphi C (strain RKS4594)
A9MUG8 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PCH6 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SYN7 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella newport (strain SL254)
B4TB82 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella heidelberg (strain SL476)
B5R824 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWC8 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella enteritidis PT4 (strain P125109)
B5FNB9 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella dublin (strain CT_02021853)
Q57RQ0 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella choleraesuis (strain SC-B67)
B5EZC1 8.36e-20 89 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella agona (strain SL483)
A1JQE8 1.01e-19 89 31 7 194 3 nagB Glucosamine-6-phosphate deaminase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5FBU7 1.28e-19 88 26 4 200 3 nagB Glucosamine-6-phosphate deaminase Aliivibrio fischeri (strain MJ11)
Q5E294 1.28e-19 88 26 4 200 3 nagB Glucosamine-6-phosphate deaminase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q64XP2 1.58e-19 88 27 5 199 3 nagB Glucosamine-6-phosphate deaminase Bacteroides fragilis (strain YCH46)
Q5LGU0 1.58e-19 88 27 5 199 3 nagB Glucosamine-6-phosphate deaminase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B1KFS0 1.59e-19 88 25 5 236 3 nagB Glucosamine-6-phosphate deaminase Shewanella woodyi (strain ATCC 51908 / MS32)
B3GZ06 1.67e-19 88 27 4 192 3 nagB Glucosamine-6-phosphate deaminase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N353 1.67e-19 88 27 4 192 3 nagB Glucosamine-6-phosphate deaminase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BSS6 1.85e-19 88 27 4 192 3 nagB Glucosamine-6-phosphate deaminase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q8FJX7 2.01e-19 88 29 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B0TTP5 2.04e-19 87 26 4 196 3 nagB Glucosamine-6-phosphate deaminase Shewanella halifaxensis (strain HAW-EB4)
B2RJ01 2.6e-19 87 30 4 184 3 nagB Glucosamine-6-phosphate deaminase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
C3LWT7 2.62e-19 87 27 4 192 3 nagB Glucosamine-6-phosphate deaminase Vibrio cholerae serotype O1 (strain M66-2)
Q9KKS5 2.62e-19 87 27 4 192 1 nagB Glucosamine-6-phosphate deaminase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F125 2.62e-19 87 27 4 192 3 nagB Glucosamine-6-phosphate deaminase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A9MKA9 3.12e-19 87 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8AJE0 3.99e-19 87 29 5 192 3 nagB Glucosamine-6-phosphate deaminase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q7MW43 4.12e-19 87 30 4 184 3 nagB Glucosamine-6-phosphate deaminase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A8GB41 4.84e-19 87 28 8 237 3 nagB Glucosamine-6-phosphate deaminase Serratia proteamaculans (strain 568)
A7MQT6 5.1e-19 87 29 5 194 3 nagB Glucosamine-6-phosphate deaminase Cronobacter sakazakii (strain ATCC BAA-894)
B7VTI0 5.36e-19 87 25 4 200 3 nagB Glucosamine-6-phosphate deaminase Vibrio atlanticus (strain LGP32)
B8HAX3 5.75e-19 86 32 5 184 3 nagB Glucosamine-6-phosphate deaminase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q6MSF4 6.23e-19 86 25 8 236 3 nagB Glucosamine-6-phosphate deaminase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q32IQ2 6.25e-19 86 26 8 264 3 nagB Glucosamine-6-phosphate deaminase Shigella dysenteriae serotype 1 (strain Sd197)
Q54XK9 6.35e-19 86 24 4 201 3 gnpda1 Glucosamine-6-phosphate isomerase Dictyostelium discoideum
Q87K60 6.44e-19 86 27 4 192 3 nagB Glucosamine-6-phosphate deaminase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P59688 8.48e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Shigella flexneri
Q0T6S6 8.48e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Shigella flexneri serotype 5b (strain 8401)
Q3Z4C2 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Shigella sonnei (strain Ss046)
Q324M6 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Shigella boydii serotype 4 (strain Sb227)
B2TU53 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LKT5 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1REP9 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli (strain UTI89 / UPEC)
B1LLC0 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli (strain SMS-3-5 / SECEC)
B6HYN6 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli (strain SE11)
B7N9S4 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A759 9.39e-19 86 28 5 194 1 nagB Glucosamine-6-phosphate deaminase Escherichia coli (strain K12)
B1IY50 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TK13 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8T7 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O1:K1 / APEC
A7ZXT7 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O9:H4 (strain HS)
B1X6L1 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli (strain K12 / DH10B)
C4ZWF4 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5J6 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O8 (strain IAI1)
B7MPI3 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O81 (strain ED1a)
B7NMM9 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YQM0 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A760 9.39e-19 86 28 5 194 2 nagB Glucosamine-6-phosphate deaminase Escherichia coli O157:H7
B7L9L4 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli (strain 55989 / EAEC)
B7MFT4 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UKV0 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJ60 9.39e-19 86 28 5 194 3 nagB Glucosamine-6-phosphate deaminase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q6D7J9 9.68e-19 86 25 6 237 3 nagB Glucosamine-6-phosphate deaminase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A0KIG3 9.78e-19 86 27 4 200 3 nagB Glucosamine-6-phosphate deaminase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SPM2 1.25e-18 85 27 4 200 3 nagB Glucosamine-6-phosphate deaminase Aeromonas salmonicida (strain A449)
A4W844 1.43e-18 85 28 5 192 3 nagB Glucosamine-6-phosphate deaminase Enterobacter sp. (strain 638)
B4ESJ0 2.06e-18 85 26 4 202 3 nagB Glucosamine-6-phosphate deaminase Proteus mirabilis (strain HI4320)
C6DBY4 2.23e-18 85 26 7 237 3 nagB Glucosamine-6-phosphate deaminase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B0UUN2 4.1e-18 84 26 4 195 3 nagB Glucosamine-6-phosphate deaminase Histophilus somni (strain 2336)
Q0I4B9 4.54e-18 84 26 4 195 3 nagB Glucosamine-6-phosphate deaminase Histophilus somni (strain 129Pt)
A6LHV2 5.18e-18 84 26 4 191 3 nagB Glucosamine-6-phosphate deaminase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q8A094 5.23e-18 84 26 4 186 3 nagB Glucosamine-6-phosphate deaminase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q7VR99 6.25e-18 84 27 5 194 3 nagB Glucosamine-6-phosphate deaminase Blochmanniella floridana
Q7MGE1 7.54e-18 83 25 4 192 3 nagB Glucosamine-6-phosphate deaminase Vibrio vulnificus (strain YJ016)
Q8D4T9 7.54e-18 83 25 4 192 3 nagB Glucosamine-6-phosphate deaminase Vibrio vulnificus (strain CMCP6)
C1AW66 8.38e-18 83 28 5 207 3 nagB Glucosamine-6-phosphate deaminase Rhodococcus opacus (strain B4)
Q7MB61 9.81e-18 83 25 5 197 3 nagB Glucosamine-6-phosphate deaminase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2VBN5 1.41e-17 83 26 4 194 3 nagB Glucosamine-6-phosphate deaminase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B3PBV0 1.83e-17 82 27 5 200 3 nagB Glucosamine-6-phosphate deaminase Cellvibrio japonicus (strain Ueda107)
Q17QL1 2e-17 82 26 4 192 2 GNPDA2 Glucosamine-6-phosphate isomerase 2 Bos taurus
C5BGA6 2.18e-17 82 25 6 237 3 nagB Glucosamine-6-phosphate deaminase Edwardsiella ictaluri (strain 93-146)
A4FV08 3.83e-17 82 27 4 192 1 GNPDA1 Glucosamine-6-phosphate isomerase 1 Bos taurus
Q8EWM7 4.17e-17 81 27 8 188 3 nagB Glucosamine-6-phosphate deaminase Malacoplasma penetrans (strain HF-2)
C5BY94 4.2e-17 81 28 4 194 3 nagB Glucosamine-6-phosphate deaminase Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
P59689 4.99e-17 81 27 4 186 3 nagB Glucosamine-6-phosphate deaminase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P44538 5.8e-17 81 26 4 194 3 nagB Glucosamine-6-phosphate deaminase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1SS81 7.42e-17 80 27 4 194 3 nagB Glucosamine-6-phosphate deaminase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
P46926 8.53e-17 81 26 4 192 1 GNPDA1 Glucosamine-6-phosphate isomerase 1 Homo sapiens
Q64422 8.97e-17 81 26 4 192 2 GNPDA1 Glucosamine-6-phosphate isomerase 1 Mesocricetus auratus
B8F877 1.05e-16 80 26 8 236 3 nagB Glucosamine-6-phosphate deaminase Glaesserella parasuis serovar 5 (strain SH0165)
A4IHW6 1.05e-16 80 25 4 192 2 gnpda2 Glucosamine-6-phosphate isomerase 2 Xenopus tropicalis
A6L7Q8 1.24e-16 80 25 4 193 3 nagB Glucosamine-6-phosphate deaminase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A0QU88 1.24e-16 80 28 5 226 1 nagB Glucosamine-6-phosphate deaminase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O88958 1.38e-16 80 26 4 192 1 Gnpda1 Glucosamine-6-phosphate isomerase 1 Mus musculus
Q5R8T8 1.62e-16 80 26 4 192 2 GNPDA1 Glucosamine-6-phosphate isomerase 1 Pongo abelii
Q8TDQ7 1.64e-16 80 26 4 192 1 GNPDA2 Glucosamine-6-phosphate isomerase 2 Homo sapiens
A8FRI2 1.65e-16 80 26 4 193 3 nagB Glucosamine-6-phosphate deaminase Shewanella sediminis (strain HAW-EB3)
Q65QE8 1.72e-16 80 25 6 208 3 nagB Glucosamine-6-phosphate deaminase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B6EN78 2.78e-16 79 25 4 192 3 nagB Glucosamine-6-phosphate deaminase Aliivibrio salmonicida (strain LFI1238)
A5UB10 3.41e-16 79 25 4 194 3 nagB Glucosamine-6-phosphate deaminase Haemophilus influenzae (strain PittEE)
Q0SGH6 4.07e-16 79 27 5 207 3 nagB Glucosamine-6-phosphate deaminase Rhodococcus jostii (strain RHA1)
Q9CRC9 5.46e-16 79 25 4 191 1 Gnpda2 Glucosamine-6-phosphate isomerase 2 Mus musculus
Q9K487 5.67e-16 78 25 4 193 2 nagB Glucosamine-6-phosphate deaminase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4QP46 5.92e-16 78 25 4 194 1 nagB Glucosamine-6-phosphate deaminase Haemophilus influenzae (strain 86-028NP)
C4LL80 6.07e-16 78 29 5 186 3 nagB Glucosamine-6-phosphate deaminase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
Q6PA43 7.13e-16 78 25 4 192 2 gnpda2 Glucosamine-6-phosphate isomerase 2 Xenopus laevis
B1VI88 1.14e-15 77 27 6 194 3 nagB Glucosamine-6-phosphate deaminase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
Q98QJ9 9.21e-15 75 21 4 188 3 nagB Glucosamine-6-phosphate deaminase Mycoplasmopsis pulmonis (strain UAB CTIP)
C3PJW6 1.63e-14 74 31 4 192 3 nagB Glucosamine-6-phosphate deaminase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q73QV6 1.76e-14 74 25 4 186 3 nagB Glucosamine-6-phosphate deaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7VKN1 1.89e-14 74 24 4 194 3 nagB Glucosamine-6-phosphate deaminase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B2RZL5 1.95e-14 74 23 4 195 3 nagB Glucosamine-6-phosphate deaminase Borrelia hermsii (strain HS1 / DAH)
Q6AAI8 4.01e-14 73 26 6 241 3 nagB Glucosamine-6-phosphate deaminase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q29NT9 5.28e-14 73 22 4 194 3 Gnpda1 Glucosamine-6-phosphate isomerase Drosophila pseudoobscura pseudoobscura
P42912 6.53e-14 72 25 7 223 3 agaI Putative deaminase AgaI Escherichia coli (strain K12)
C4L889 6.53e-14 72 26 5 194 3 nagB Glucosamine-6-phosphate deaminase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q16HW7 6.86e-14 72 25 4 194 3 Gnpda1 Glucosamine-6-phosphate isomerase Aedes aegypti
Q9XVJ2 7.3e-14 72 26 4 191 3 T03F6.3 Probable glucosamine-6-phosphate isomerase Caenorhabditis elegans
Q3ID09 1.91e-13 71 22 8 257 3 nagB Glucosamine-6-phosphate deaminase Pseudoalteromonas translucida (strain TAC 125)
Q5TNH5 3.02e-13 71 24 5 204 3 Gnpda1 Glucosamine-6-phosphate isomerase Anopheles gambiae
Q9VMP9 4.61e-13 70 22 4 194 2 Oscillin Glucosamine-6-phosphate isomerase Drosophila melanogaster
A4QH44 7.54e-13 69 25 4 193 3 nagB Glucosamine-6-phosphate deaminase Corynebacterium glutamicum (strain R)
Q8NMD4 2.56e-12 68 25 4 193 3 nagB Glucosamine-6-phosphate deaminase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B7GQA1 6.1e-12 67 26 4 201 3 nagB Glucosamine-6-phosphate deaminase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8G4N5 7e-12 67 25 4 201 3 nagB Glucosamine-6-phosphate deaminase Bifidobacterium longum (strain NCC 2705)
B3DQQ9 8.75e-12 67 25 4 201 3 nagB Glucosamine-6-phosphate deaminase Bifidobacterium longum (strain DJO10A)
B7J183 3.1e-11 65 23 4 202 3 nagB Glucosamine-6-phosphate deaminase Borreliella burgdorferi (strain ZS7)
O30564 3.1e-11 65 23 4 202 1 nagB Glucosamine-6-phosphate deaminase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q6NJ91 4.07e-11 64 26 6 195 3 nagB Glucosamine-6-phosphate deaminase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q0SP13 1.18e-10 63 24 4 202 3 nagB Glucosamine-6-phosphate deaminase Borreliella afzelii (strain PKo)
Q662L3 2.68e-09 59 22 4 195 3 nagB Glucosamine-6-phosphate deaminase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q04802 3.1e-09 59 25 9 189 1 NAG1 Glucosamine-6-phosphate isomerase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8AB53 9.81e-09 58 22 8 235 3 BT_0258 Putative glucosamine-6-phosphate deaminase-like protein BT_0258 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8FMI6 5.25e-07 52 23 9 254 3 nagB Glucosamine-6-phosphate deaminase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P31470 4.7e-05 47 27 2 111 3 yieK Uncharacterized protein YieK Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04935
Feature type CDS
Gene -
Product glucosamine-6-phosphate deaminase
Location 1049063 - 1049839 (strand: 1)
Length 777 (nucleotides) / 258 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_329
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01182 Glucosamine-6-phosphate isomerases/6-phosphogluconolactonase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0363 Carbohydrate transport and metabolism (G) G 6-phosphogluconolactonase/Glucosamine-6-phosphate isomerase/deaminase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02564 glucosamine-6-phosphate deaminase [EC:3.5.99.6] Amino sugar and nucleotide sugar metabolism
Metabolic pathways		 -

Protein Sequence

MSDTPITTGQKGKLQYAVYADRNAMGRAAAEKARDIILACQASQPAVRIVFASAPSQNEFLQHLQSFREIDWSKVTAFHMDEYIGLPPGAPQAFSHYIQAHLFDAVKPAATCFIRAHATDSEAECRRYSALLNAAPIDLVCLGVGENGHIAFNDPWVADFNDPAVVKRVQLDEQCRQQQVNDGCFARTDDVPLYALTLTIPALFSARHMVCVVPAATKRRAVCAMINDTISEDLPATILRRHNSAFLYLDPDSGADLC

Flanking regions ( +/- flanking 50bp)

TGAATACCGCTTTAAAGAGGCTGCTATGCACCTGTCAGAGGAACATATTAATGTCTGATACACCCATTACCACAGGTCAGAAAGGTAAGTTACAGTACGCCGTTTATGCAGATCGCAATGCCATGGGTCGCGCTGCCGCAGAAAAAGCCCGCGACATCATCCTTGCCTGCCAGGCGTCACAACCTGCGGTACGCATTGTTTTTGCCTCCGCACCATCACAGAATGAATTTTTACAGCATCTGCAATCATTTCGTGAAATAGACTGGTCAAAAGTAACCGCATTTCACATGGATGAATATATCGGGTTGCCGCCGGGCGCACCGCAGGCATTCAGCCACTATATTCAGGCGCATTTGTTTGATGCGGTCAAGCCCGCCGCCACCTGTTTTATCCGCGCCCATGCGACGGACAGCGAAGCCGAGTGCCGCCGCTACAGTGCGTTACTCAACGCCGCGCCTATTGATTTGGTTTGCCTCGGTGTCGGGGAAAATGGTCATATTGCGTTTAATGACCCGTGGGTGGCTGACTTTAATGATCCGGCAGTGGTTAAACGGGTGCAGCTTGATGAACAGTGCCGTCAGCAACAGGTTAATGACGGCTGCTTTGCCCGGACTGATGATGTGCCGCTTTATGCCCTGACACTGACAATCCCCGCGCTTTTCAGCGCCCGCCACATGGTGTGTGTGGTGCCTGCTGCAACGAAACGCCGGGCTGTCTGCGCGATGATAAACGACACTATCAGCGAAGATTTACCCGCTACTATTCTTCGCCGCCACAACAGTGCATTTTTATATCTCGATCCGGATTCGGGGGCTGATTTATGCTGAACAGCACAGAAAAACGCATTGAGGGAAAAACGCTGAAGGGTGATGCTATT