Homologs in group_2543

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02480 FBDBKF_02480 74.4 Morganella morganii S1 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
EHELCC_02950 EHELCC_02950 74.4 Morganella morganii S2 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
NLDBIP_00510 NLDBIP_00510 74.4 Morganella morganii S4 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
LHKJJB_01525 LHKJJB_01525 74.4 Morganella morganii S3 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
HKOGLL_01565 HKOGLL_01565 74.4 Morganella morganii S5 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain

Distribution of the homologs in the orthogroup group_2543

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2543

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q01856 1.07e-49 178 29 5 425 3 RHOS4_30730 Uncharacterized HTH-type transcriptional regulator RHOS4_30730 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P96663 8.03e-41 154 26 8 441 3 ydeF Uncharacterized HTH-type transcriptional regulator YdeF Bacillus subtilis (strain 168)
Q796Q6 1.48e-29 123 25 12 461 3 yisV Uncharacterized HTH-type transcriptional regulator YisV Bacillus subtilis (strain 168)
P95957 2.63e-26 113 28 6 277 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P39389 1.82e-25 111 24 11 468 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
Q72LL6 2.06e-25 110 23 4 329 1 lysN 2-aminoadipate transaminase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P96681 1.08e-22 103 23 15 463 3 ydfD Uncharacterized HTH-type transcriptional regulator YdfD Bacillus subtilis (strain 168)
H3ZPL1 4.6e-22 101 24 4 330 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P77730 8.26e-20 95 24 10 410 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
P49309 1.01e-18 92 22 7 396 3 mocR Probable rhizopine catabolism regulatory protein MocR Rhizobium meliloti
Q8NS92 1.79e-17 87 25 10 431 3 pdxR HTH-type pyridoxine biosynthesis transcriptional regulator PdxR Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q9HUI9 4.94e-16 83 29 9 263 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q64602 1.09e-14 79 23 6 311 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Rattus norvegicus
Q5HJR1 7.54e-14 76 23 12 400 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain COL)
Q2G1P1 7.54e-14 76 23 12 400 1 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKF1 7.54e-14 76 23 12 400 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain USA300)
Q9WVM8 6.34e-13 73 26 2 203 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Mus musculus
Q7A875 1.12e-12 73 23 12 400 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain N315)
Q99XA5 1.12e-12 73 23 12 400 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q08792 1.77e-12 72 22 8 295 3 ycxD Uncharacterized HTH-type transcriptional regulator YcxD Bacillus subtilis (strain 168)
P96669 2.21e-12 72 21 9 369 3 ydeL Uncharacterized HTH-type transcriptional regulator YdeL Bacillus subtilis (strain 168)
Q2YUS3 4.01e-12 71 22 13 401 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain bovine RF122 / ET3-1)
D5AKX9 6.85e-12 70 24 10 389 1 tauR HTH-type transcriptional regulator TauR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q5E9N4 1.3e-11 69 23 7 278 2 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Bos taurus
Q8N5Z0 4.39e-11 68 23 11 313 1 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Homo sapiens
O58489 6.61e-11 67 21 6 282 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O66630 2.54e-10 65 22 10 298 3 dapL LL-diaminopimelate aminotransferase Aquifex aeolicus (strain VF5)
O07578 2.96e-10 65 21 12 375 3 yhdI Uncharacterized HTH-type transcriptional regulator YhdI Bacillus subtilis (strain 168)
Q7NDX4 1.07e-09 63 23 11 314 1 dapL LL-diaminopimelate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P10356 2.18e-09 62 27 11 259 1 YER152C Uncharacterized protein YER152C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q86AG8 3.08e-09 62 20 9 364 3 DDB_G0272014 Aromatic amino acid aminotransferase DDB_G0272014 Dictyostelium discoideum
O87320 3.82e-09 62 26 12 259 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
Q9Y7S6 4.18e-09 62 22 10 387 3 SPCC569.07 Aromatic amino acid aminotransferase C569.07 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3ZXC8 8.79e-09 60 22 8 296 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
P94426 1.34e-08 60 22 15 389 1 gabR HTH-type transcriptional regulatory protein GabR Bacillus subtilis (strain 168)
Q56232 1.64e-08 60 24 6 245 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B8DJJ6 1.69e-08 60 24 12 307 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A5FRC5 1.78e-08 59 22 8 296 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
O94570 2.28e-08 59 23 7 267 3 SPBC1773.13 Aromatic amino acid aminotransferase C1773.13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O52815 4.36e-08 58 25 9 298 1 hpgT (S)-3,5-dihydroxyphenylglycine transaminase Amycolatopsis orientalis
B8CX89 7.47e-08 57 22 13 339 3 dapL LL-diaminopimelate aminotransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
P16524 1.04e-07 57 21 8 304 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
Q3MDN5 1.1e-07 57 20 12 348 3 dapL2 LL-diaminopimelate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q4L4E7 1.35e-07 57 24 8 264 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
Q30ZX9 1.45e-07 57 23 13 307 3 dapL LL-diaminopimelate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
O33822 1.68e-07 56 25 5 240 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
C6C2Z3 2.67e-07 56 24 13 304 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
Q8NXN3 5.2e-07 55 21 11 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 5.2e-07 55 21 11 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
A0LEA5 5.89e-07 55 23 14 333 1 dapL LL-diaminopimelate aminotransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q54K00 6.3e-07 55 19 12 377 3 DDB_G0287711 Aromatic amino acid aminotransferase DDB_G0287711 Dictyostelium discoideum
Q72BI1 8.62e-07 54 23 12 306 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VDD3 8.78e-07 54 23 12 306 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
A8YZZ5 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 1.02e-06 54 21 10 314 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 1.02e-06 54 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GIR8 1.12e-06 53 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MRSA252)
Q3AC10 1.22e-06 53 23 15 304 3 dapL LL-diaminopimelate aminotransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P18485 1.72e-06 53 21 15 362 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Solanum lycopersicum
Q9SNN8 1.75e-06 53 24 11 270 2 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Oryza sativa subsp. japonica
Q2YSI3 1.83e-06 53 21 10 314 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q07262 2.01e-06 53 22 15 355 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Nicotiana tabacum
Q84CG1 2.71e-06 53 26 5 194 1 vioD Capreomycidine synthase Streptomyces vinaceus
Q2RK33 2.81e-06 53 26 10 242 1 dapL LL-diaminopimelate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q972A2 3.14e-06 52 26 7 205 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
O14192 6.42e-06 52 26 10 268 3 SPAC56E4.03 Aromatic amino acid aminotransferase C56E4.03 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P54590 6.96e-06 48 37 0 69 4 yhcF Uncharacterized HTH-type transcriptional regulator YhcF Bacillus subtilis (strain 168)
P40193 1.23e-05 51 22 11 443 1 ptsJ Vitamin B6 salvage pathway transcriptional repressor PtsJ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A7XRY8 1.74e-05 50 21 6 259 1 tdiD Aminotransferase tdiD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A3CNT7 1.83e-05 50 24 4 170 3 hisC Histidinol-phosphate aminotransferase Streptococcus sanguinis (strain SK36)
Q253K9 2.26e-05 50 26 8 192 3 dapL LL-diaminopimelate aminotransferase Chlamydia felis (strain Fe/C-56)
Q5HR08 2.34e-05 50 23 11 308 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CTG8 2.36e-05 50 23 11 308 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P14909 2.47e-05 50 27 9 204 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9PK04 2.76e-05 49 25 7 166 3 dapL LL-diaminopimelate aminotransferase Chlamydia muridarum (strain MoPn / Nigg)
Q97ES6 3.06e-05 49 22 12 301 3 hisC Histidinol-phosphate aminotransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q4J8X2 3.85e-05 49 25 7 240 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
D4AU29 3.96e-05 49 21 9 310 3 swnA Aminotransferase swnA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
O93744 4.46e-05 49 23 6 209 3 aspC Aspartate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q06402 4.69e-05 49 21 15 361 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Arabidopsis thaliana
P39643 8.79e-05 48 23 14 352 1 bacF Transaminase BacF Bacillus subtilis (strain 168)
Q795M6 0.000138 47 25 8 241 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q3UX83 0.00016 47 21 11 296 2 Accsl Probable inactive 1-aminocyclopropane-1-carboxylate synthase-like protein 2 Mus musculus
Q00379 0.000166 47 21 15 360 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Cucurbita pepo
O84395 0.000184 47 25 8 171 1 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KLW3 0.000184 47 25 8 171 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
E9L7A5 0.000184 47 25 6 205 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
P23279 0.000192 47 21 15 360 1 ACC1A 1-aminocyclopropane-1-carboxylate synthase 1 Cucurbita pepo
Q8GYY0 0.000216 47 20 9 259 2 ACS12 Probable aminotransferase ACS12 Arabidopsis thaliana
P29535 0.000239 47 25 8 186 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Solanum lycopersicum
B0KQJ6 0.000368 46 23 7 249 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain GB-1)
Q8ESS3 0.000445 45 23 4 163 3 hisC1 Histidinol-phosphate aminotransferase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P96847 0.000466 45 27 11 244 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A8AY31 0.00048 45 22 6 203 3 hisC Histidinol-phosphate aminotransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B0BC25 0.000484 45 24 7 166 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7W0 0.000484 45 24 7 166 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
A0KKB7 0.000502 45 26 9 209 3 hisC Histidinol-phosphate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
O14209 0.000543 45 24 9 254 3 SPAC6B12.04c Uncharacterized aminotransferase C6B12.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P53090 0.000597 45 25 5 170 1 ARO8 Aromatic/aminoadipate aminotransferase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C6BUK3 0.000629 45 21 10 275 3 dapL LL-diaminopimelate aminotransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q49VS0 0.000725 45 20 10 315 3 hisC Histidinol-phosphate aminotransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A1BGB4 0.000808 45 23 6 174 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8ZKR0 0.000809 44 30 0 68 4 STM4068 HTH-type transcriptional repressor STM4068 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2NTX2 0.000816 45 24 12 249 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
Q88P86 0.001 45 22 7 252 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04855
Feature type CDS
Gene -
Product PLP-dependent aminotransferase family protein
Location 1032182 - 1033519 (strand: 1)
Length 1338 (nucleotides) / 445 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2543
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II
PF00392 Bacterial regulatory proteins, gntR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1167 Transcription (K)
Amino acid transport and metabolism (E)		 KE DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain

Protein Sequence

MAAPRYKCYVDTIAARILSGELPPGTKLPAHRTFAADEKTSLVTASRIYKELISLGLVRGETGRGTFVRDISLLPTFSIEQDVMPEMYDLNFIYPEITGQETLLRRSLRQLSMSGDLDSLLHYQPHAGRRHERVITAQHLKLRGFSSVNPETVVIVSGAQHGLATIVLGMFSPGDVIATDALTYPGFKALAQMYHIDLVAIPITESGPDLTAFAQICGHRKIRGYFTMPTLHNPLGWVMDLSSRKALINLARKHQFWLIEDGSYSFLQKTAPPPLAELAPDITFYVTGFSKNIATGFRVGLVVAPPEQIANLERIIRITTWNTPALTTAIISEWLEQGDAEKLEKRKRRDAKNRQDIVRRIFTDFPYIAHPCSYFLWIPLPPGVRCDIVISHLRDANIVVSSAESYAVTRDIPQAIRVAISSLTYDELEMVLQTIKQAIVYFIDF

Flanking regions ( +/- flanking 50bp)

CTAATACTGATAATCATGACAATCAAAAAATTGTCATGGATACACTTCAAATGGCCGCACCACGTTATAAATGCTACGTCGATACAATCGCAGCCCGTATCCTGAGTGGTGAGCTACCTCCGGGGACTAAATTACCCGCACACAGAACATTTGCTGCTGATGAGAAGACCTCATTAGTGACAGCGTCACGGATATATAAAGAATTAATCAGTCTCGGGTTAGTCAGAGGGGAAACAGGGCGCGGAACATTTGTTCGTGATATCAGTTTGTTACCAACATTTAGTATTGAACAGGATGTCATGCCGGAAATGTATGATCTTAATTTTATTTATCCGGAAATTACAGGACAGGAAACACTGCTGCGCCGTTCATTACGTCAGTTATCCATGAGTGGTGATCTGGACAGTCTGTTGCATTATCAGCCTCACGCCGGACGGCGTCATGAACGCGTAATAACGGCACAACACCTGAAATTACGCGGATTTTCATCCGTTAATCCGGAAACGGTCGTTATAGTGAGTGGCGCACAACATGGTCTTGCCACCATTGTGCTGGGCATGTTCAGCCCGGGAGATGTTATTGCAACTGATGCCCTGACATACCCTGGTTTCAAGGCACTGGCACAAATGTATCATATTGATTTAGTAGCAATTCCTATTACAGAATCCGGCCCTGATTTAACGGCATTTGCTCAAATATGCGGACACCGGAAGATCCGTGGTTATTTCACCATGCCAACACTGCATAATCCGCTGGGTTGGGTGATGGATTTATCATCCCGTAAGGCATTGATTAACCTTGCAAGAAAGCATCAATTCTGGCTGATAGAAGATGGTTCATACTCTTTTTTGCAAAAAACGGCACCACCGCCATTGGCTGAGCTTGCACCGGATATCACATTTTATGTGACCGGATTTTCCAAAAATATTGCGACCGGCTTTCGTGTGGGATTGGTTGTTGCACCACCGGAACAGATTGCCAATCTTGAGCGCATCATCCGTATTACGACATGGAACACGCCTGCACTAACAACGGCGATTATCAGTGAATGGTTAGAGCAGGGGGATGCAGAAAAACTGGAGAAGAGAAAACGCCGTGATGCCAAAAACCGGCAAGATATTGTCCGCAGGATTTTTACTGATTTTCCCTATATCGCCCATCCGTGCAGCTATTTTTTATGGATCCCGCTGCCTCCCGGTGTCCGTTGCGATATCGTTATCAGCCATTTGCGGGATGCTAATATAGTCGTCAGTTCCGCTGAATCTTACGCCGTCACACGGGATATTCCGCAAGCTATCCGTGTCGCAATCAGTTCACTGACGTATGACGAACTGGAAATGGTACTGCAAACAATAAAACAGGCGATAGTCTATTTTATTGATTTTTAGTCTGAAAATAAAATTCAGGCTATAAGCAGGCTACATATATTTTTAAATGA