Homologs in group_602

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01835 FBDBKF_01835 96.8 Morganella morganii S1 lrp DNA-binding transcriptional regulator, Lrp family
EHELCC_02305 EHELCC_02305 96.8 Morganella morganii S2 lrp DNA-binding transcriptional regulator, Lrp family
NLDBIP_01155 NLDBIP_01155 96.8 Morganella morganii S4 lrp DNA-binding transcriptional regulator, Lrp family
LHKJJB_00880 LHKJJB_00880 96.8 Morganella morganii S3 lrp DNA-binding transcriptional regulator, Lrp family
HKOGLL_00920 HKOGLL_00920 96.8 Morganella morganii S5 lrp DNA-binding transcriptional regulator, Lrp family
PMI_RS06925 PMI_RS06925 76.0 Proteus mirabilis HI4320 - Lrp/AsnC family transcriptional regulator

Distribution of the homologs in the orthogroup group_602

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_602

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A2S0 1.92e-37 129 38 0 149 3 lrp Leucine-responsive regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O07920 3.14e-37 128 40 0 154 4 azlB Transcriptional regulator AzlB Bacillus subtilis (strain 168)
P37424 5.16e-37 127 38 0 149 3 lrp Leucine-responsive regulatory protein Klebsiella pneumoniae
P0ACJ3 7.88e-37 127 38 0 149 3 lrp Leucine-responsive regulatory protein Shigella flexneri
P0ACJ4 7.88e-37 127 38 0 149 3 lrp Leucine-responsive regulatory protein Klebsiella aerogenes
P0ACJ0 7.88e-37 127 38 0 149 1 lrp Leucine-responsive regulatory protein Escherichia coli (strain K12)
P0ACJ1 7.88e-37 127 38 0 149 3 lrp Leucine-responsive regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACJ2 7.88e-37 127 38 0 149 3 lrp Leucine-responsive regulatory protein Escherichia coli O157:H7
P37425 8.23e-37 127 38 0 149 3 lrp Leucine-responsive regulatory protein Serratia marcescens
P45265 2.54e-35 123 40 0 150 3 lrp Leucine-responsive regulatory protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42179 4.97e-32 114 35 1 151 4 bkdR Bkd operon transcriptional regulator Pseudomonas putida
P56901 8.93e-31 111 37 0 145 3 lrp Leucine-responsive regulatory protein Rhizobium meliloti (strain 1021)
Q9I1M3 4.17e-29 107 35 0 151 3 bkdR Bkd operon transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACJ5 2.7e-28 105 34 0 150 1 decR DNA-binding transcriptional activator DecR Escherichia coli (strain K12)
P0ACJ6 2.7e-28 105 34 0 150 3 decR DNA-binding transcriptional activator DecR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACJ7 2.7e-28 105 34 0 150 3 decR DNA-binding transcriptional activator DecR Escherichia coli O157:H7
Q44333 4.67e-27 102 30 0 146 4 putR Proline dehydrogenase transcriptional activator Rhizobium radiobacter
Q52710 6.32e-27 101 33 0 142 4 putR Proline dehydrogenase transcriptional activator Rhodobacter capsulatus
P0DJA5 1.34e-23 93 31 1 151 3 grp Glutamate uptake regulatory protein Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
F8DT92 1.34e-23 93 31 1 151 4 grp Glutamate uptake regulatory protein Zymomonas mobilis subsp. mobilis (strain ATCC 10988 / DSM 424 / LMG 404 / NCIMB 8938 / NRRL B-806 / ZM1)
E1V7V9 3.65e-21 87 31 0 145 3 doeX Transcriptional regulatory protein DoeX Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9)
P50337 1.13e-20 84 35 0 105 4 NGR_a01600 Uncharacterized HTH-type transcriptional regulator y4sM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55658 2.16e-20 85 28 0 153 4 NGR_a01550 Uncharacterized HTH-type transcriptional regulator y4tD Sinorhizobium fredii (strain NBRC 101917 / NGR234)
F8DT24 4.79e-20 84 32 1 149 4 zrp HTH-type transcriptional regulator Zrp Zymomonas mobilis subsp. mobilis (strain ATCC 10988 / DSM 424 / LMG 404 / NCIMB 8938 / NRRL B-806 / ZM1)
P0DJA6 7.76e-20 83 32 1 149 4 zrp HTH-type transcriptional regulator Zrp Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
O59188 7.97e-20 83 29 2 154 1 fl11 HTH-type transcriptional regulator FL11 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9V0Y9 4.35e-18 79 29 3 155 3 fl11 HTH-type transcriptional regulator FL11 Pyrococcus abyssi (strain GE5 / Orsay)
Q8U0P3 3.86e-17 76 28 2 150 3 fl11 HTH-type transcriptional regulator FL11 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P44580 1.93e-15 72 28 0 150 4 HI_0224 Uncharacterized HTH-type transcriptional regulator HI_0224 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O57880 2.36e-15 72 28 2 151 1 PH0140 Uncharacterized HTH-type transcriptional regulator PH0140 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8U4M7 2.95e-14 68 29 2 147 4 PF0054 Uncharacterized HTH-type transcriptional regulator PF0054 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9UY16 3.14e-14 68 27 0 143 4 PYRAB16920 Uncharacterized HTH-type transcriptional regulator PYRAB16920 Pyrococcus abyssi (strain GE5 / Orsay)
Q58133 4.21e-14 68 30 3 146 1 ptr2 HTH-type transcriptional regulator Ptr2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O59579 4.96e-14 68 27 0 143 4 PH1916 Uncharacterized HTH-type transcriptional regulator PH1916 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9V2D7 6.33e-14 68 27 2 151 4 PYRAB01370 Uncharacterized HTH-type transcriptional regulator PYRAB01370 Pyrococcus abyssi (strain GE5 / Orsay)
Q57615 7.75e-14 67 27 1 150 1 ptr1 HTH-type transcriptional regulator Ptr1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P96582 1.38e-12 64 30 1 121 1 lrpC HTH-type transcriptional regulator LrpC Bacillus subtilis (strain 168)
O31497 3e-12 63 28 1 119 4 yezC Uncharacterized HTH-type transcriptional regulator YezC Bacillus subtilis (strain 168)
Q8U1H7 4.1e-12 63 27 1 147 4 PF1231 Uncharacterized HTH-type transcriptional regulator PF1231 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O57818 5.7e-12 63 31 0 122 4 PH0045 Uncharacterized HTH-type transcriptional regulator PH0045 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P44337 1.65e-11 61 25 1 140 3 asnC Regulatory protein AsnC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8U445 2.91e-11 60 23 0 143 4 PF0250 Uncharacterized HTH-type transcriptional regulator PF0250 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9V2M0 1.1e-10 59 29 0 122 4 PYRAB00550 Uncharacterized HTH-type transcriptional regulator PYRAB00550 Pyrococcus abyssi (strain GE5 / Orsay)
P42180 2.96e-08 52 26 2 145 1 lrpA HTH-type transcriptional regulator LrpA Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P0ACI9 4.91e-08 52 22 1 140 3 asnC Regulatory protein AsnC Shigella flexneri
P0ACI6 4.91e-08 52 22 1 140 1 asnC Regulatory protein AsnC Escherichia coli (strain K12)
P0ACI7 4.91e-08 52 22 1 140 3 asnC Regulatory protein AsnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACI8 4.91e-08 52 22 1 140 3 asnC Regulatory protein AsnC Escherichia coli O157:H7
P96653 6.72e-08 52 25 1 112 4 lrpB HTH-type transcriptional regulator LrpB Bacillus subtilis (strain 168)
Q9V159 1.84e-07 50 26 2 145 3 lrpA HTH-type transcriptional regulator LrpA Pyrococcus abyssi (strain GE5 / Orsay)
Q9V1E5 3.09e-07 50 24 2 143 4 PYRAB04820 Uncharacterized HTH-type transcriptional regulator PYRAB04820 Pyrococcus abyssi (strain GE5 / Orsay)
O05217 3.37e-07 50 26 2 101 4 ywrC Uncharacterized HTH-type transcriptional regulator YwrC Bacillus subtilis (strain 168)
O59256 5.05e-07 49 25 2 145 3 lrpA HTH-type transcriptional regulator LrpA Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O59309 9.25e-07 48 24 3 146 4 PH1692 Uncharacterized HTH-type transcriptional regulator PH1692 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9V2K6 1.62e-05 45 24 2 137 4 PYRAB00690 Uncharacterized HTH-type transcriptional regulator PYRAB00690 Pyrococcus abyssi (strain GE5 / Orsay)
Q8U067 2.22e-05 45 23 3 146 4 PF1734 Uncharacterized HTH-type transcriptional regulator PF1734 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P96652 4.77e-05 44 24 2 113 4 lrpA HTH-type transcriptional regulator LrpA Bacillus subtilis (strain 168)
B8J364 0.000229 42 30 3 102 1 Ddes_0286 Siroheme decarboxylase alpha subunit Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q30Y72 0.000645 41 31 2 103 1 ahbA Siroheme decarboxylase alpha subunit Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
O57802 0.000684 41 21 2 137 1 PH0061 Uncharacterized HTH-type transcriptional regulator PH0061 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04160
Feature type CDS
Gene -
Product Lrp/AsnC family transcriptional regulator
Location 878198 - 878662 (strand: 1)
Length 465 (nucleotides) / 154 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_602
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01037 Lrp/AsnC ligand binding domain
PF13412 Winged helix-turn-helix DNA-binding

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1522 Transcription (K) K DNA-binding transcriptional regulator, Lrp family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03719 Lrp/AsnC family transcriptional regulator, leucine-responsive regulatory protein - -

Protein Sequence

MSIELDKMDRRILDQLQRNGKIQNVELAREVGLSPSPCLRRVRRLEENGIIKRYAAILDGSKIGAGLMLYARIWFKGQDAQTINDFVAAINEMPEIVECHLMAGECDAMIRIVTKDLTSYRRFHADHLTQIPSIQSVKTEVPMETLKVTHALPL

Flanking regions ( +/- flanking 50bp)

AACTATTCTTAGCAATATTATTGCGCGGAAATAGTCAGGTGGTGATTTAAATGTCAATTGAACTGGATAAGATGGATCGGCGGATACTGGATCAGCTGCAACGTAACGGAAAAATTCAGAATGTGGAGCTGGCGCGGGAAGTCGGGCTGTCGCCGTCGCCCTGTCTGCGCCGGGTGCGCAGACTCGAGGAAAACGGCATTATAAAGCGCTATGCGGCGATTCTGGATGGCAGCAAGATAGGGGCGGGGCTGATGCTATACGCCCGCATATGGTTCAAAGGACAGGACGCGCAGACTATCAATGACTTTGTTGCCGCCATCAATGAAATGCCCGAAATTGTTGAGTGTCATCTGATGGCGGGTGAGTGTGATGCGATGATACGTATTGTGACTAAAGACTTAACCTCATACCGCCGGTTTCATGCCGATCATCTGACACAAATACCAAGTATTCAAAGTGTTAAGACGGAAGTGCCGATGGAGACATTAAAGGTCACACATGCATTACCCCTGTAGAATGTGAGGAACATCACTAAACGCAACGTAATTGTGCACTGTGACAGGTT