Homologs in group_1812

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13440 FBDBKF_13440 87.5 Morganella morganii S1 mltE Soluble lytic murein transglycosylase or regulatory protein s ( may contain LysM/invasin domain)
EHELCC_08655 EHELCC_08655 87.5 Morganella morganii S2 mltE Soluble lytic murein transglycosylase or regulatory protein s ( may contain LysM/invasin domain)
NLDBIP_08980 NLDBIP_08980 87.5 Morganella morganii S4 mltE Soluble lytic murein transglycosylase or regulatory protein s ( may contain LysM/invasin domain)
LHKJJB_05285 LHKJJB_05285 87.5 Morganella morganii S3 mltE Soluble lytic murein transglycosylase or regulatory protein s ( may contain LysM/invasin domain)
HKOGLL_05630 HKOGLL_05630 87.5 Morganella morganii S5 mltE Soluble lytic murein transglycosylase or regulatory protein s ( may contain LysM/invasin domain)
PMI_RS04995 PMI_RS04995 59.1 Proteus mirabilis HI4320 - transglycosylase SLT domain-containing protein

Distribution of the homologs in the orthogroup group_1812

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1812

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A7MKC3 6.35e-63 197 58 0 160 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Cronobacter sakazakii (strain ATCC BAA-894)
A8AFS5 8.59e-62 194 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LSJ1 7.58e-61 192 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7CQE4 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGT6 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella typhi
B5BI54 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella paratyphi A (strain AKU_12601)
C0Q334 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella paratyphi C (strain RKS4594)
A9MVX1 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PN08 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5R901 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R2X1 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella enteritidis PT4 (strain P125109)
Q57NL3 1.09e-59 189 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella choleraesuis (strain SC-B67)
B7UQ77 3.5e-59 188 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A6TAW0 3.86e-59 188 55 0 160 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q3Z2V5 7.92e-59 187 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella sonnei (strain Ss046)
P0C960 7.92e-59 187 46 2 213 1 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain K12)
B1IU99 7.92e-59 187 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XAN4 7.92e-59 187 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain K12 / DH10B)
C4ZTN4 7.92e-59 187 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain K12 / MC4100 / BW2952)
Q1RCQ2 1.47e-58 186 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain UTI89 / UPEC)
B1LHX3 1.47e-58 186 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain SMS-3-5 / SECEC)
P59243 1.47e-58 186 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TII2 1.47e-58 186 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AAB6 1.47e-58 186 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O1:K1 / APEC
B7MTX1 1.47e-58 186 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O81 (strain ED1a)
B7NUV4 1.47e-58 186 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MK90 1.47e-58 186 46 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O45:K1 (strain S88 / ExPEC)
B5XQ85 2.35e-58 186 54 0 160 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Klebsiella pneumoniae (strain 342)
Q83RP9 3.23e-58 186 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella flexneri
Q0T5K7 3.23e-58 186 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella flexneri serotype 5b (strain 8401)
Q31ZN3 3.23e-58 186 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella boydii serotype 4 (strain Sb227)
B7N3Z9 3.23e-58 186 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LXA7 3.23e-58 186 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O8 (strain IAI1)
B5YXL7 3.23e-58 186 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDJ7 3.23e-58 186 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O157:H7
B7LGV3 3.23e-58 186 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain 55989 / EAEC)
A4WBE8 8.78e-58 184 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Enterobacter sp. (strain 638)
Q83RQ0 1.35e-57 184 46 2 210 3 emtA2 Endo-type membrane-bound lytic murein transglycosylase A-like protein Shigella flexneri
Q32H22 1.6e-57 184 45 2 213 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella dysenteriae serotype 1 (strain Sd197)
A5UDW4 2.95e-48 165 50 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus influenzae (strain PittEE)
B0UWE6 1.15e-47 163 49 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Histophilus somni (strain 2336)
Q0I513 1.15e-47 163 49 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Histophilus somni (strain 129Pt)
Q65VT8 1.78e-47 162 47 0 164 3 mltC Membrane-bound lytic murein transglycosylase C Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P44049 2.15e-47 162 50 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QMD8 2.15e-47 162 50 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus influenzae (strain 86-028NP)
A5UHR5 2.25e-47 162 50 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus influenzae (strain PittGG)
Q9CLB8 1.41e-46 160 46 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Pasteurella multocida (strain Pm70)
A6VLS0 1.83e-45 157 47 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q6D8K0 4.67e-45 156 46 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7N7I2 7e-45 156 46 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7MLX9 3.86e-44 154 44 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Cronobacter sakazakii (strain ATCC BAA-894)
B1LDH3 4.43e-44 154 44 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain SMS-3-5 / SECEC)
Q2NRB3 7.78e-44 153 44 2 159 3 mltC Membrane-bound lytic murein transglycosylase C Sodalis glossinidius (strain morsitans)
A8GJ50 1.31e-43 152 44 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Serratia proteamaculans (strain 568)
A4WEA0 1.94e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Enterobacter sp. (strain 638)
Q83Q83 2.19e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Shigella flexneri
Q0T0S4 2.19e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Shigella flexneri serotype 5b (strain 8401)
B7MZB8 2.85e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O81 (strain ED1a)
B5YQG2 2.85e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCS6 2.85e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O157:H7
B6I7A0 2.95e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain SE11)
B7NI32 2.95e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q32C32 3.04e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Shigella dysenteriae serotype 1 (strain Sd197)
Q31WM5 3.04e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Shigella boydii serotype 4 (strain Sb227)
B2U178 3.04e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7N7L9 3.04e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1ISK6 3.04e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A4A6 3.04e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O9:H4 (strain HS)
B7LFM1 3.04e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain 55989 / EAEC)
A7ZR89 3.04e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R762 3.11e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain UTI89 / UPEC)
P0C066 3.11e-43 152 43 0 158 1 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain K12)
P0C067 3.11e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TDN8 3.11e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AFE9 3.11e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O1:K1 / APEC
B1XFC3 3.11e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain K12 / DH10B)
C5A0N2 3.11e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain K12 / MC4100 / BW2952)
B7MN10 3.11e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UI10 3.11e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LYZ3 3.24e-43 152 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O8 (strain IAI1)
Q3YXF0 7.27e-43 150 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Shigella sonnei (strain Ss046)
B7LPT3 8.53e-43 150 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
C5BCE9 9.09e-43 150 42 0 163 3 mltC Membrane-bound lytic murein transglycosylase C Edwardsiella ictaluri (strain 93-146)
A8API2 1.21e-42 150 43 0 155 3 mltC Membrane-bound lytic murein transglycosylase C Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B8F6F0 1.25e-42 150 46 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Glaesserella parasuis serovar 5 (strain SH0165)
Q57K03 1.53e-42 150 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella choleraesuis (strain SC-B67)
Q8ZM39 1.56e-42 150 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N4R0 1.56e-42 150 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PMM0 1.56e-42 150 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z3T9 2.22e-42 149 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella typhi
A9MQR3 3.09e-42 149 42 0 161 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A1JPV7 3.47e-42 149 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6TDX1 5.72e-42 148 43 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q666M2 1.69e-41 147 41 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TI58 1.69e-41 147 41 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis (strain Pestoides F)
Q1CEV1 1.69e-41 147 41 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6R2 1.69e-41 147 41 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis bv. Antiqua (strain Angola)
Q8ZHE6 1.69e-41 147 41 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis
B2K0V2 1.69e-41 147 41 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CB94 1.69e-41 147 41 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis bv. Antiqua (strain Antiqua)
A7FEX3 1.69e-41 147 41 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5XU88 1.98e-41 147 42 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Klebsiella pneumoniae (strain 342)
B0BSH0 1.48e-40 145 46 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GYW8 1.48e-40 145 46 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N339 1.48e-40 145 46 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Actinobacillus pleuropneumoniae serotype 5b (strain L20)
P57352 3.03e-40 140 45 1 144 3 mltE Membrane-bound lytic murein transglycosylase E Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AM2 4.04e-40 139 47 0 160 3 mltE Membrane-bound lytic murein transglycosylase E Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7VKB7 9.94e-38 137 44 0 158 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O31608 1.69e-10 61 34 1 90 1 cwlQ Bifunctional muramidase/lytic transglycosylase CwlQ Bacillus subtilis (strain 168)
P0AGC3 3.16e-07 53 39 2 94 1 slt Soluble lytic murein transglycosylase Escherichia coli (strain K12)
P0AGC4 3.16e-07 53 39 2 94 3 slt Soluble lytic murein transglycosylase Escherichia coli O157:H7
Q1I5L3 5.6e-06 50 26 6 163 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas entomophila (strain L48)
Q2SK06 4.33e-05 47 27 6 162 3 mltF Membrane-bound lytic murein transglycosylase F Hahella chejuensis (strain KCTC 2396)
Q3KHL5 5.83e-05 47 28 7 177 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas fluorescens (strain Pf0-1)
P39434 0.000114 46 33 3 101 3 slt Soluble lytic murein transglycosylase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A4XXV1 0.000162 45 25 4 163 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas mendocina (strain ymp)
B1JDH3 0.000307 44 25 6 163 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas putida (strain W619)
Q4ZX03 0.000871 43 25 6 163 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas syringae pv. syringae (strain B728a)
P44888 0.000899 43 29 2 105 3 slt Putative soluble lytic murein transglycosylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03325
Feature type CDS
Gene -
Product transglycosylase SLT domain-containing protein
Location 708527 - 709207 (strand: 1)
Length 681 (nucleotides) / 226 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1812
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01464 Transglycosylase SLT domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0741 Cell wall/membrane/envelope biogenesis (M) M Soluble lytic murein transglycosylase or regulatory protein s ( may contain LysM/invasin domain)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08308 peptidoglycan lytic transglycosylase E [EC:4.2.2.29] - -

Protein Sequence

MKKTVSVIAIALLIAGCSGSNKQTRTGGWINKTPSADYDASLFPAQGDGNSVYPATPFDQFIRQASNSYEIDETLIRAIIEVESSYRPDVISKSNAVGLMQIKASTAGRDAYRMKGRNGEPSTRDLLDPQTNIDIGTTYIRIIRDQHLAGITNPQTLNYATIVSYVNGAGALLRTFDNNRALAITKINALSPDEFYEHVRRKHPAPQAPRYLWKVKNAYSALAMSD

Flanking regions ( +/- flanking 50bp)

CATTTTCAGTATTCTTTACGCCAGAAGAACGCCGGATAAAGGGTAGCACAGTGAAAAAAACCGTTAGTGTGATTGCAATAGCATTATTGATAGCGGGTTGCTCAGGAAGTAATAAACAGACCCGTACCGGCGGCTGGATAAATAAGACACCGTCCGCTGATTATGACGCTTCGTTGTTTCCTGCACAGGGAGACGGAAATAGTGTTTATCCGGCGACACCTTTTGATCAGTTTATCCGCCAGGCATCCAATAGTTATGAAATCGATGAAACACTGATCCGCGCTATTATTGAAGTGGAATCCTCTTACCGGCCTGATGTTATCAGTAAATCGAATGCTGTCGGTCTGATGCAGATTAAAGCCTCTACTGCCGGGCGTGATGCTTACCGCATGAAAGGGCGTAATGGCGAGCCATCAACCCGTGACCTGCTTGATCCGCAAACCAACATTGATATCGGCACAACGTATATCCGTATTATCCGTGATCAGCACCTTGCCGGTATTACCAATCCGCAAACACTCAATTACGCCACCATTGTCTCTTATGTGAACGGCGCCGGTGCATTATTGCGCACATTTGATAATAACCGCGCACTGGCAATTACAAAAATCAATGCATTGTCACCGGATGAGTTTTATGAGCATGTCCGGCGCAAACATCCGGCACCGCAGGCTCCGCGCTATTTGTGGAAAGTCAAAAACGCATACAGTGCTCTGGCAATGTCAGACTGACGGTCAGTAATGACATGTTGGGTACAGAGCGTAGCGAAAAACATAAAAAA