Homologs in group_2196

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16550 FBDBKF_16550 97.1 Morganella morganii S1 upp uracil phosphoribosyltransferase
EHELCC_08415 EHELCC_08415 97.1 Morganella morganii S2 upp uracil phosphoribosyltransferase
NLDBIP_08740 NLDBIP_08740 97.1 Morganella morganii S4 upp uracil phosphoribosyltransferase
LHKJJB_05525 LHKJJB_05525 97.1 Morganella morganii S3 upp uracil phosphoribosyltransferase
HKOGLL_05390 HKOGLL_05390 97.1 Morganella morganii S5 upp uracil phosphoribosyltransferase
PMI_RS07670 PMI_RS07670 89.9 Proteus mirabilis HI4320 upp uracil phosphoribosyltransferase

Distribution of the homologs in the orthogroup group_2196

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2196

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EY88 1.73e-138 388 89 0 208 3 upp Uracil phosphoribosyltransferase Proteus mirabilis (strain HI4320)
A6TCB0 1.03e-133 376 87 0 208 1 upp Uracil phosphoribosyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B1JSF5 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668E6 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMP2 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis (strain Pestoides F)
Q1CK39 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZW6 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCX9 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis
B2K9J9 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5P3 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FG38 2.19e-133 375 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5XNQ4 7e-133 374 87 0 208 3 upp Uracil phosphoribosyltransferase Klebsiella pneumoniae (strain 342)
Q7N3F8 9.1e-133 374 86 0 208 3 upp Uracil phosphoribosyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D7S0 1.35e-132 373 86 0 208 3 upp Uracil phosphoribosyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4WD70 1.94e-132 373 86 0 208 3 upp Uracil phosphoribosyltransferase Enterobacter sp. (strain 638)
A1JKZ8 2.34e-132 373 87 0 208 3 upp Uracil phosphoribosyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P0A8F3 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Shigella flexneri
Q0T222 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Shigella flexneri serotype 5b (strain 8401)
B2TXS3 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LNE8 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6I570 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain SE11)
B7N680 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8F0 3.32e-132 372 86 0 208 1 upp Uracil phosphoribosyltransferase Escherichia coli (strain K12)
B1IWG2 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8F1 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEZ0 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADZ1 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O1:K1 / APEC
A8A2Z0 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O9:H4 (strain HS)
B1XAX3 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain K12 / DH10B)
C4ZX73 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7K2 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O8 (strain IAI1)
B7MYC5 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O81 (strain ED1a)
B7NQN7 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z035 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8F2 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O157:H7
B7LCN8 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain 55989 / EAEC)
B7MHX9 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UGN6 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZPU1 3.32e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
P0A2M5 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2M6 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella typhi
B4TR74 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella schwarzengrund (strain CVM19633)
B5BB06 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella paratyphi A (strain AKU_12601)
C0PYQ8 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella paratyphi C (strain RKS4594)
A9N2Y1 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PNJ7 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0M7 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella newport (strain SL254)
B4TD73 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella heidelberg (strain SL476)
B5RCX0 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R560 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FQJ0 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella dublin (strain CT_02021853)
Q57LL1 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella choleraesuis (strain SC-B67)
A9MHP1 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F173 4.67e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Salmonella agona (strain SL483)
C6DBR1 4.72e-132 372 86 0 208 3 upp Uracil phosphoribosyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8AD93 5.09e-132 372 87 0 208 3 upp Uracil phosphoribosyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LKE4 2.95e-131 370 85 0 208 3 upp Uracil phosphoribosyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
C5BHQ5 1.37e-130 368 85 0 208 3 upp Uracil phosphoribosyltransferase Edwardsiella ictaluri (strain 93-146)
Q2NS69 5.45e-129 364 85 0 208 3 upp Uracil phosphoribosyltransferase Sodalis glossinidius (strain morsitans)
Q65RC3 7.41e-129 364 83 0 208 3 upp Uracil phosphoribosyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B8CN81 3.8e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q87MH1 4.05e-127 359 83 0 208 3 upp Uracil phosphoribosyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q12MF1 4.99e-127 359 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q084L0 1.02e-126 358 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella frigidimarina (strain NCIMB 400)
C3LPM9 1.23e-126 358 82 0 208 3 upp Uracil phosphoribosyltransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F642 1.23e-126 358 82 0 208 3 upp Uracil phosphoribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MIK2 3.22e-126 357 82 0 208 3 upp Uracil phosphoribosyltransferase Vibrio vulnificus (strain YJ016)
A0KYA2 3.4e-126 357 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sp. (strain ANA-3)
Q9CPL8 3.56e-126 357 81 0 208 3 upp Uracil phosphoribosyltransferase Pasteurella multocida (strain Pm70)
A3QD33 4.1e-126 357 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A4SL29 5.28e-126 357 82 0 208 3 upp Uracil phosphoribosyltransferase Aeromonas salmonicida (strain A449)
A9KY39 5.39e-126 357 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella baltica (strain OS195)
A6WM35 5.39e-126 357 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella baltica (strain OS185)
A3D3D2 5.39e-126 357 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAL3 5.39e-126 357 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella baltica (strain OS223)
A1RKQ4 6.43e-126 356 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sp. (strain W3-18-1)
A4Y5T9 6.43e-126 356 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1S7E5 7.66e-126 356 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q6LN74 7.83e-126 356 82 0 208 3 upp Uracil phosphoribosyltransferase Photobacterium profundum (strain SS9)
B0BTQ3 9.33e-126 356 81 0 208 3 upp Uracil phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H0R2 9.33e-126 356 81 0 208 3 upp Uracil phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZB6 9.33e-126 356 81 0 208 3 upp Uracil phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A6VQ76 9.43e-126 356 82 0 208 3 upp Uracil phosphoribosyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q0HTW9 1.11e-125 356 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sp. (strain MR-7)
Q0HHL7 1.11e-125 356 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sp. (strain MR-4)
Q8EDI9 1.11e-125 356 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9KPY7 1.19e-125 356 82 0 208 3 upp Uracil phosphoribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B6EJU2 1.65e-125 355 82 0 208 3 upp Uracil phosphoribosyltransferase Aliivibrio salmonicida (strain LFI1238)
A0KM23 2.08e-125 355 81 0 208 3 upp Uracil phosphoribosyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B1KIG8 6.5e-125 354 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
B5FGY4 7.58e-125 353 81 0 208 3 upp Uracil phosphoribosyltransferase Aliivibrio fischeri (strain MJ11)
A8H5Q9 9.03e-125 353 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TPW8 9.03e-125 353 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella halifaxensis (strain HAW-EB4)
B0UW86 2.15e-124 352 81 0 208 3 upp Uracil phosphoribosyltransferase Histophilus somni (strain 2336)
Q0I4P2 2.15e-124 352 81 0 208 3 upp Uracil phosphoribosyltransferase Histophilus somni (strain 129Pt)
A8FUD4 7.09e-124 351 82 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sediminis (strain HAW-EB3)
B8F5N2 1.21e-123 351 80 0 208 3 upp Uracil phosphoribosyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
A1SVA9 2.92e-123 350 80 0 208 3 upp Uracil phosphoribosyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7VM34 3.02e-123 350 79 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P43857 1.51e-122 348 79 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UF76 1.51e-122 348 79 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus influenzae (strain PittGG)
A5UBP1 1.51e-122 348 79 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus influenzae (strain PittEE)
C4LC66 1.58e-122 348 79 0 208 3 upp Uracil phosphoribosyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q4QJV5 1.08e-121 346 78 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus influenzae (strain 86-028NP)
Q492F3 1.72e-116 333 74 0 208 3 upp Uracil phosphoribosyltransferase Blochmanniella pennsylvanica (strain BPEN)
A1AMK6 3.41e-110 317 71 0 208 3 upp Uracil phosphoribosyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B3E677 5.11e-110 316 69 0 208 3 upp Uracil phosphoribosyltransferase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q1IEV9 3.51e-109 314 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas entomophila (strain L48)
B1JEN1 5.74e-109 314 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas putida (strain W619)
Q88PV2 1.49e-108 313 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KNF7 1.49e-108 313 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas putida (strain GB-1)
A5VYH8 1.49e-108 313 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q7VRS9 1.88e-108 312 75 0 208 3 upp Uracil phosphoribosyltransferase Blochmanniella floridana
A4XQU8 9.57e-107 308 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas mendocina (strain ymp)
Q4K6B5 1.1e-106 308 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K6Y9 1.22e-106 308 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q47W53 1.43e-106 307 69 0 208 3 upp Uracil phosphoribosyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
C3KAJ8 2.71e-106 307 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas fluorescens (strain SBW25)
C1DEU0 3.09e-106 307 69 0 208 3 upp Uracil phosphoribosyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C1DC78 4.83e-106 306 65 0 208 3 upp Uracil phosphoribosyltransferase Laribacter hongkongensis (strain HLHK9)
A4VPB2 4.84e-106 306 68 0 208 3 upp Uracil phosphoribosyltransferase Stutzerimonas stutzeri (strain A1501)
Q4ZXU7 1.88e-105 305 68 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q48MT3 1.88e-105 305 68 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q888A0 2.45e-105 305 68 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7NS06 3.66e-105 304 65 0 208 3 upp Uracil phosphoribosyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
C6BSG3 1.44e-104 302 69 0 208 3 upp Uracil phosphoribosyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C0QHT9 1.58e-104 302 68 0 208 3 upp Uracil phosphoribosyltransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B8DP34 2.18e-104 302 67 0 208 3 upp Uracil phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q311Z9 7.67e-104 301 67 0 208 3 upp Uracil phosphoribosyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A1U241 1.29e-103 300 69 0 208 3 upp Uracil phosphoribosyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2SN06 1.85e-103 300 66 0 208 3 upp Uracil phosphoribosyltransferase Hahella chejuensis (strain KCTC 2396)
P59001 5.01e-103 298 66 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q9HVE6 5.49e-103 298 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02G28 5.49e-103 298 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V0J2 5.49e-103 298 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas aeruginosa (strain LESB58)
Q9RBJ3 8.57e-103 298 66 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RRQ3 8.57e-103 298 66 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UVY0 8.57e-103 298 66 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q2P2V7 1.65e-102 297 65 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A6VC42 2.35e-102 297 68 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas aeruginosa (strain PA7)
Q1QVR2 2.5e-102 297 66 1 209 3 upp Uracil phosphoribosyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3BS29 9.43e-102 295 65 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3IC38 1.2e-101 295 68 1 208 3 upp Uracil phosphoribosyltransferase Pseudoalteromonas translucida (strain TAC 125)
B4SS22 5.21e-101 293 64 0 208 3 upp Uracil phosphoribosyltransferase Stenotrophomonas maltophilia (strain R551-3)
A1VEW8 5.67e-101 293 66 0 208 3 upp Uracil phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72DA4 5.67e-101 293 66 0 208 3 upp Uracil phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C4XJX5 7.45e-101 293 67 0 208 3 upp Uracil phosphoribosyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B2FLX2 1.04e-100 293 64 0 208 3 upp Uracil phosphoribosyltransferase Stenotrophomonas maltophilia (strain K279a)
A9HZV9 2.42e-100 292 65 0 208 3 upp Uracil phosphoribosyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q6AQH2 4.21e-100 291 68 0 201 3 upp Uracil phosphoribosyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B2SDI9 6.6e-100 291 66 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IZ90 1.48e-99 290 66 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NGW1 1.48e-99 290 66 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q5K6 1.48e-99 290 66 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. novicida (strain U112)
Q2KWB3 2.69e-99 289 64 0 208 3 upp Uracil phosphoribosyltransferase Bordetella avium (strain 197N)
Q2A285 6.73e-99 288 66 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. holarctica (strain LVS)
Q7VZ79 7.07e-99 288 63 0 207 3 upp Uracil phosphoribosyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B0TYR5 1.34e-98 287 66 1 209 3 upp Uracil phosphoribosyltransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A2SGT8 2.56e-98 286 64 0 208 3 upp Uracil phosphoribosyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q9JV58 2.58e-98 286 63 0 208 3 upp Uracil phosphoribosyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K048 3.96e-98 286 63 0 208 3 upp Uracil phosphoribosyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7WB58 4.7e-98 286 62 0 207 3 upp Uracil phosphoribosyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMM5 4.7e-98 286 62 0 207 3 upp Uracil phosphoribosyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1KT34 9.61e-98 285 63 0 208 3 upp Uracil phosphoribosyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M3K6 9.61e-98 285 63 0 208 3 upp Uracil phosphoribosyltransferase Neisseria meningitidis serogroup C (strain 053442)
B0V8B1 4.42e-97 283 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain AYE)
B0VU43 4.42e-97 283 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain SDF)
B2HU54 4.42e-97 283 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain ACICU)
B7I752 4.42e-97 283 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain AB0057)
B7GZA8 4.42e-97 283 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain AB307-0294)
A3M2R1 4.93e-97 283 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B4RK50 1.39e-96 282 62 0 208 3 upp Uracil phosphoribosyltransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F9P0 1.39e-96 282 62 0 208 3 upp Uracil phosphoribosyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
C6DZH8 5.07e-96 281 63 1 209 3 upp Uracil phosphoribosyltransferase Geobacter sp. (strain M21)
B8IZH6 6.73e-96 280 62 0 208 3 upp Uracil phosphoribosyltransferase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q6FE58 1.17e-95 280 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B5EBM3 3.84e-95 278 62 1 209 3 upp Uracil phosphoribosyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q15ZS0 1.21e-94 277 67 1 209 3 upp Uracil phosphoribosyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q74EM9 3.25e-89 264 65 1 209 3 upp Uracil phosphoribosyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q38WJ8 1.18e-82 247 56 0 207 3 upp Uracil phosphoribosyltransferase Latilactobacillus sakei subsp. sakei (strain 23K)
Q93CX7 1.18e-82 247 56 0 207 3 upp Uracil phosphoribosyltransferase Latilactobacillus sakei
Q9CEC9 6.81e-82 245 56 1 209 3 upp Uracil phosphoribosyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
P50926 2.91e-81 243 56 1 209 3 upp Uracil phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q02WM7 3.75e-81 243 56 1 209 3 upp Uracil phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q04DP1 6.4e-81 243 55 0 207 3 upp Uracil phosphoribosyltransferase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q03A25 6.4e-81 243 55 0 207 3 upp Uracil phosphoribosyltransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WDL1 6.4e-81 243 55 0 207 3 upp Uracil phosphoribosyltransferase Lacticaseibacillus casei (strain BL23)
Q5KUI3 4.48e-80 240 55 0 207 3 upp Uracil phosphoribosyltransferase Geobacillus kaustophilus (strain HTA426)
Q927V5 5.51e-80 240 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q97RQ3 5.95e-80 240 55 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B9E8F4 7.17e-80 240 56 0 207 3 upp Uracil phosphoribosyltransferase Macrococcus caseolyticus (strain JCSC5402)
Q8DQI3 7.33e-80 240 55 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B9DTU7 1.04e-79 239 55 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q97F73 1.04e-79 239 54 0 207 3 upp Uracil phosphoribosyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A0ALM3 1.32e-79 239 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y4B3 1.32e-79 239 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DBH1 1.32e-79 239 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q71WP0 1.32e-79 239 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KYV5 1.32e-79 239 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q9RE01 1.68e-79 239 53 0 207 3 upp Uracil phosphoribosyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A3CPK9 1.84e-79 239 55 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus sanguinis (strain SK36)
A8AYQ0 2.31e-79 239 55 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P0DH35 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48V26 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RG73 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J888 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JID6 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JN85 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
P67402 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDM5 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DH34 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P67400 4.4e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M1
Q03EK5 6.04e-79 238 55 0 207 3 upp Uracil phosphoribosyltransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q03QY1 6.18e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
C0MGT4 6.89e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus equi subsp. zooepidemicus (strain H70)
B4U4M9 6.89e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M7M9 6.89e-79 238 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus equi subsp. equi (strain 4047)
P36399 8.3e-79 237 54 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus salivarius
Q9K6G5 1.01e-78 237 53 0 207 3 upp Uracil phosphoribosyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8XIC4 2.76e-78 236 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium perfringens (strain 13 / Type A)
Q0TNB4 2.76e-78 236 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SQY5 3.08e-78 236 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium perfringens (strain SM101 / Type A)
Q03M79 3.51e-78 236 54 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5U5 3.51e-78 236 54 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1A9 3.51e-78 236 54 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus thermophilus (strain CNRZ 1066)
Q8DST6 5.74e-78 235 54 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P67399 6.55e-78 235 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67398 6.55e-78 235 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q3JZU9 6.55e-78 235 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P70881 1.01e-77 234 54 0 207 1 upp Uracil phosphoribosyltransferase Bacillus caldolyticus
B5XJZ7 1.14e-77 234 52 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M49 (strain NZ131)
C5D9M4 1.42e-77 234 54 0 207 3 upp Uracil phosphoribosyltransferase Geobacillus sp. (strain WCH70)
C4Z9S1 1.54e-77 234 54 0 207 3 upp Uracil phosphoribosyltransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
A6LQG6 2.02e-77 234 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q1WUD3 2.2e-77 234 51 0 207 3 upp Uracil phosphoribosyltransferase Ligilactobacillus salivarius (strain UCC118)
Q04BB0 2.2e-77 234 55 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAX2 2.2e-77 234 55 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q831G0 3.45e-77 233 53 0 207 3 upp Uracil phosphoribosyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
A4VWM9 6.29e-77 233 53 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus suis (strain 05ZYH33)
B2TJY9 7.17e-77 232 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
B2UZI9 7.17e-77 232 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Alaska E43 / Type E3)
Q5WB67 1.22e-76 232 53 0 207 3 upp Uracil phosphoribosyltransferase Shouchella clausii (strain KSM-K16)
Q67TC9 1.92e-76 231 50 0 207 3 upp Uracil phosphoribosyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A0Q306 4.54e-76 230 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium novyi (strain NT)
B0T2R0 5.72e-76 230 53 0 206 3 upp Uracil phosphoribosyltransferase Caulobacter sp. (strain K31)
Q9RGY8 6.17e-76 230 55 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A5N3J1 6.38e-76 230 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DX75 6.38e-76 230 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium kluyveri (strain NBRC 12016)
Q8CRN4 9.14e-76 229 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMB1 9.14e-76 229 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B9JYP9 1.3e-75 229 53 0 206 3 upp Uracil phosphoribosyltransferase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B7GMG3 1.36e-75 229 52 0 207 3 upp Uracil phosphoribosyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B0S2A9 1.55e-75 229 51 0 207 3 upp Uracil phosphoribosyltransferase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q180X8 3.14e-75 228 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridioides difficile (strain 630)
B2G680 5.03e-75 228 51 1 209 3 upp Uracil phosphoribosyltransferase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIQ0 5.03e-75 228 51 1 209 3 upp Uracil phosphoribosyltransferase Limosilactobacillus reuteri (strain DSM 20016)
Q92T49 9.37e-75 227 54 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium meliloti (strain 1021)
A1B467 1.19e-74 227 52 0 206 3 upp Uracil phosphoribosyltransferase Paracoccus denitrificans (strain Pd 1222)
A8YUJ4 1.67e-74 226 54 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus helveticus (strain DPC 4571)
B1HM47 1.82e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Lysinibacillus sphaericus (strain C3-41)
Q898X9 2.4e-74 226 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium tetani (strain Massachusetts / E88)
P67397 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain MW2)
A8YY79 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G7J8 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain MSSA476)
Q6GEW3 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain MRSA252)
P67396 2.42e-74 226 52 0 207 1 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain N315)
P67395 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIV6 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain Newman)
Q5HE88 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain COL)
Q2YUJ2 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUQ7 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain JH9)
Q2FWE6 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF16 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain USA300)
A6U3J7 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain JH1)
A7X4V6 2.42e-74 226 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L7Z3 2.86e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
B9J6V7 1.07e-73 224 53 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
C0Z818 1.29e-73 224 50 0 207 3 upp Uracil phosphoribosyltransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A6UET4 1.45e-73 224 53 0 206 3 upp Uracil phosphoribosyltransferase Sinorhizobium medicae (strain WSM419)
Q8UJ06 1.55e-73 224 52 0 206 3 upp Uracil phosphoribosyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
A9VSB3 1.62e-73 224 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus mycoides (strain KBAB4)
A0RLA2 1.62e-73 224 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus thuringiensis (strain Al Hakam)
A7GV65 1.97e-73 224 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B1KSR7 2.2e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
A7G9P8 2.2e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE69 2.2e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Okra / Type B1)
C1FQA3 2.2e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Kyoto / Type A2)
A5HY41 2.2e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYI1 2.2e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain 657 / Type Ba4)
A7FQG8 2.2e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
B9DMF2 2.35e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus carnosus (strain TM300)
Q49Z59 2.54e-73 223 53 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5SIQ7 2.86e-73 223 50 0 208 3 upp Uracil phosphoribosyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72J35 2.86e-73 223 50 0 208 1 upp Uracil phosphoribosyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A8MJX1 3.68e-73 223 50 0 207 3 upp Uracil phosphoribosyltransferase Alkaliphilus oremlandii (strain OhILAs)
Q24MM7 4.29e-73 223 49 0 207 3 upp Uracil phosphoribosyltransferase Desulfitobacterium hafniense (strain Y51)
B8FZ68 4.29e-73 223 49 0 207 3 upp Uracil phosphoribosyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B5ZXI2 4.34e-73 223 53 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q65DW6 4.43e-73 223 52 0 207 3 upp Uracil phosphoribosyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q576P9 4.53e-73 223 52 0 208 3 upp Uracil phosphoribosyltransferase Brucella abortus biovar 1 (strain 9-941)
B2SC51 4.53e-73 223 52 0 208 3 upp Uracil phosphoribosyltransferase Brucella abortus (strain S19)
B3PXN0 4.78e-73 223 52 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium etli (strain CIAT 652)
A5VVW9 4.89e-73 223 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
B0K1G2 4.94e-73 223 51 0 203 3 upp Uracil phosphoribosyltransferase Thermoanaerobacter sp. (strain X514)
B0K7G1 4.94e-73 223 51 0 203 3 upp Uracil phosphoribosyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q042K8 5.76e-73 223 51 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q6HAX0 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630T4 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain ZK / E33L)
Q814V3 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B9IRU7 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain Q1)
B7HY75 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain AH187)
B7HFL2 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain B4264)
C1F0N8 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain 03BB102)
B7IQW8 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain G9842)
Q72XD8 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JGP0 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain AH820)
Q81JY5 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus anthracis
C3LFI9 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1G4 5.95e-73 222 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus anthracis (strain A0248)
Q1MMV8 9.62e-73 222 52 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A8FIC0 1.39e-72 221 51 0 207 3 upp Uracil phosphoribosyltransferase Bacillus pumilus (strain SAFR-032)
Q8YDE5 1.46e-72 221 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMK4 1.46e-72 221 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella melitensis biotype 2 (strain ATCC 23457)
A6WYH9 1.64e-72 221 52 0 208 3 upp Uracil phosphoribosyltransferase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8RD94 2.28e-72 221 51 0 203 3 upp Uracil phosphoribosyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8FUZ2 2.75e-72 221 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella suis biovar 1 (strain 1330)
A9WW75 2.75e-72 221 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9MCZ3 2.75e-72 221 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P39149 2.78e-72 221 53 0 207 3 upp Uracil phosphoribosyltransferase Bacillus subtilis (strain 168)
A6TK51 3e-72 221 49 0 207 3 upp Uracil phosphoribosyltransferase Alkaliphilus metalliredigens (strain QYMF)
B8E009 3.03e-72 221 51 0 203 3 upp Uracil phosphoribosyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q7M8H6 3.77e-72 220 51 0 208 3 upp Uracil phosphoribosyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
C3MBH2 3.89e-72 220 52 0 206 3 upp Uracil phosphoribosyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B8GYP3 4.34e-72 220 52 0 207 3 upp Uracil phosphoribosyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A627 4.34e-72 220 52 0 207 3 upp Uracil phosphoribosyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B2GAT5 5.4e-72 220 50 1 203 3 upp Uracil phosphoribosyltransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A9KIB0 6.23e-72 220 51 0 207 3 upp Uracil phosphoribosyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A3DIL9 6.51e-72 220 51 0 201 3 upp Uracil phosphoribosyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9RU32 1.29e-71 219 51 2 211 3 upp Uracil phosphoribosyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B2A3H5 3.46e-71 218 50 0 207 3 upp Uracil phosphoribosyltransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B1YEG7 3.61e-71 218 51 0 207 3 upp Uracil phosphoribosyltransferase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B5YDB8 5.41e-71 217 49 0 203 3 upp Uracil phosphoribosyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A7Z9Q8 1.04e-70 217 51 0 207 3 upp Uracil phosphoribosyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A9NEQ2 2.44e-70 216 51 1 207 3 upp Uracil phosphoribosyltransferase Acholeplasma laidlawii (strain PG-8A)
B8I567 3.42e-70 215 50 0 201 3 upp Uracil phosphoribosyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q8RG35 6.97e-70 214 50 1 208 3 upp Uracil phosphoribosyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A1WQN5 9.77e-70 214 49 0 207 3 upp Uracil phosphoribosyltransferase Verminephrobacter eiseniae (strain EF01-2)
C5CLM9 3.74e-69 213 49 0 203 3 upp Uracil phosphoribosyltransferase Variovorax paradoxus (strain S110)
C1ARF7 4.17e-69 213 50 2 206 3 upp Uracil phosphoribosyltransferase Rhodococcus opacus (strain B4)
Q5WUK0 6.51e-69 212 50 0 207 3 upp Uracil phosphoribosyltransferase Legionella pneumophila (strain Lens)
Q5X340 6.51e-69 212 50 0 207 3 upp Uracil phosphoribosyltransferase Legionella pneumophila (strain Paris)
Q0SK44 6.67e-69 212 49 2 206 3 upp Uracil phosphoribosyltransferase Rhodococcus jostii (strain RHA1)
A1VN11 6.74e-69 212 49 0 203 3 upp Uracil phosphoribosyltransferase Polaromonas naphthalenivorans (strain CJ2)
B9MJ16 8.67e-69 212 51 0 203 3 upp Uracil phosphoribosyltransferase Acidovorax ebreus (strain TPSY)
A1W748 1.16e-68 211 51 0 203 3 upp Uracil phosphoribosyltransferase Acidovorax sp. (strain JS42)
C4KYT2 1.27e-68 211 50 0 207 3 upp Uracil phosphoribosyltransferase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A9BWD4 1.31e-68 211 50 0 203 3 upp Uracil phosphoribosyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q8EM74 1.33e-68 211 49 0 201 3 upp Uracil phosphoribosyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5ZTB9 1.74e-68 211 49 0 207 3 upp Uracil phosphoribosyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IE48 1.74e-68 211 49 0 207 3 upp Uracil phosphoribosyltransferase Legionella pneumophila (strain Corby)
A7NRA6 2.17e-68 211 50 1 201 3 upp Uracil phosphoribosyltransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B0TI63 2.7e-68 211 49 0 207 3 upp Uracil phosphoribosyltransferase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q2ST42 4.76e-68 210 51 1 208 3 upp Uracil phosphoribosyltransferase Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q8XXC7 4.84e-68 210 51 3 205 3 upp Uracil phosphoribosyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q98GV3 1.28e-67 209 52 0 206 3 upp Uracil phosphoribosyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B2JE33 1.17e-66 207 50 3 205 3 upp Uracil phosphoribosyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q6MS86 3.47e-66 205 50 1 208 3 upp Uracil phosphoribosyltransferase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
A5UQV0 8.03e-66 204 48 1 201 3 upp Uracil phosphoribosyltransferase Roseiflexus sp. (strain RS-1)
Q9WZI0 7.84e-65 202 49 0 203 1 upp Uracil phosphoribosyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1JW40 9.9e-65 202 50 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia orbicola (strain MC0-3)
B1YU48 9.9e-65 202 50 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia ambifaria (strain MC40-6)
Q0BD86 1.07e-64 202 50 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B5ZAU8 1.26e-64 201 49 3 207 3 upp Uracil phosphoribosyltransferase Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
B2U8Z0 1.34e-64 201 49 3 205 3 upp Uracil phosphoribosyltransferase Ralstonia pickettii (strain 12J)
B2T2A6 1.82e-64 201 49 3 205 3 upp Uracil phosphoribosyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B9KAQ6 2.03e-64 201 48 0 203 3 upp Uracil phosphoribosyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q142L5 2.91e-64 201 49 3 205 3 upp Uracil phosphoribosyltransferase Paraburkholderia xenovorans (strain LB400)
B4E5R5 3.01e-64 201 49 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q39EA2 4.31e-64 200 49 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1L7Y5 4.49e-64 200 47 0 203 3 upp Uracil phosphoribosyltransferase Thermotoga sp. (strain RQ2)
A5IJ64 4.49e-64 200 47 0 203 3 upp Uracil phosphoribosyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A9AJK1 6.6e-64 199 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q9PR28 7.19e-64 199 48 0 203 3 upp Uracil phosphoribosyltransferase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIA5 7.19e-64 199 48 0 203 3 upp Uracil phosphoribosyltransferase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A4JGH4 1.4e-63 199 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q2SZS9 1.8e-63 199 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A6LMU0 2.6e-63 198 47 0 208 3 upp Uracil phosphoribosyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q63VS8 4.07e-63 197 49 3 205 1 upp Uracil phosphoribosyltransferase Burkholderia pseudomallei (strain K96243)
Q3JUF6 4.07e-63 197 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia pseudomallei (strain 1710b)
A3NT50 4.07e-63 197 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia pseudomallei (strain 1106a)
A1V2G4 4.07e-63 197 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia mallei (strain SAVP1)
Q62IJ1 4.07e-63 197 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4B1 4.07e-63 197 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia mallei (strain NCTC 10229)
A3MI49 4.07e-63 197 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia mallei (strain NCTC 10247)
Q6F210 5.52e-63 197 49 1 208 3 upp Uracil phosphoribosyltransferase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A3N7G1 6.65e-63 197 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia pseudomallei (strain 668)
A7HJR3 1.04e-62 196 48 0 203 3 upp Uracil phosphoribosyltransferase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q1DG16 1.77e-62 196 46 0 207 3 upp Uracil phosphoribosyltransferase Myxococcus xanthus (strain DK1622)
B7IDR9 2.16e-62 196 46 0 208 3 upp Uracil phosphoribosyltransferase Thermosipho africanus (strain TCF52B)
Q89E48 1.45e-61 193 48 0 206 3 upp Uracil phosphoribosyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6KHA6 6.33e-61 192 46 0 203 3 upp Uracil phosphoribosyltransferase Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
A7ZFB7 3.54e-60 190 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter concisus (strain 13826)
Q8EUA1 5.99e-60 189 47 1 201 3 upp Uracil phosphoribosyltransferase Malacoplasma penetrans (strain HF-2)
Q5HTC1 1.27e-59 188 42 1 202 3 upp Uracil phosphoribosyltransferase Campylobacter jejuni (strain RM1221)
A1W0S0 2.14e-59 188 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FMZ1 2.14e-59 188 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9PN13 2.63e-59 187 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A5CNC6 4.31e-59 187 44 1 209 3 upp Uracil phosphoribosyltransferase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q82FS4 7.36e-59 187 46 1 208 3 upp Uracil phosphoribosyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A0RR59 1.21e-58 186 44 3 207 3 upp Uracil phosphoribosyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
B6IW12 1.56e-58 186 47 2 205 3 upp Uracil phosphoribosyltransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
A7H0F9 1.58e-58 186 39 1 202 3 upp Uracil phosphoribosyltransferase Campylobacter curvus (strain 525.92)
Q9PJJ6 2.3e-58 188 43 0 202 3 upp Uracil phosphoribosyltransferase Chlamydia muridarum (strain MoPn / Nigg)
Q7NBH2 2.68e-57 182 43 2 211 3 upp Uracil phosphoribosyltransferase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
B1VNY5 2.89e-57 182 45 1 209 3 upp Uracil phosphoribosyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
C5BXA3 7.12e-57 182 44 1 209 3 upp Uracil phosphoribosyltransferase Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
Q9AK76 6.63e-56 179 44 1 208 3 upp Uracil phosphoribosyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P43049 6.95e-56 179 42 2 205 3 upp Uracil phosphoribosyltransferase Metamycoplasma hominis
A0JSM6 1.25e-55 178 44 1 208 3 upp Uracil phosphoribosyltransferase Arthrobacter sp. (strain FB24)
B2GFU4 2.03e-55 178 44 1 208 3 upp Uracil phosphoribosyltransferase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q6AHB4 5.98e-55 177 44 1 209 3 upp Uracil phosphoribosyltransferase Leifsonia xyli subsp. xyli (strain CTCB07)
B3PM96 6.83e-55 176 42 0 203 3 upp Uracil phosphoribosyltransferase Metamycoplasma arthritidis (strain 158L3-1)
A6W572 1.2e-54 176 43 1 209 3 upp Uracil phosphoribosyltransferase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
B2HDV9 1.6e-54 176 43 1 208 3 upp Uracil phosphoribosyltransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q2S320 7.71e-54 174 44 2 211 3 upp Uracil phosphoribosyltransferase Salinibacter ruber (strain DSM 13855 / M31)
B8HCL2 2.84e-53 172 42 1 208 3 upp Uracil phosphoribosyltransferase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q5MZF4 3.75e-53 172 41 4 212 3 upp Uracil phosphoribosyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31MH4 3.75e-53 172 41 4 212 3 upp Uracil phosphoribosyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q6A5S3 3.91e-53 172 43 1 210 3 upp Uracil phosphoribosyltransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
P9WFF3 4.01e-53 172 43 2 212 1 upp Uracil phosphoribosyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFF2 4.01e-53 172 43 2 212 3 upp Uracil phosphoribosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U7Y3 4.01e-53 172 43 2 212 3 upp Uracil phosphoribosyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KNZ5 4.01e-53 172 43 2 212 3 upp Uracil phosphoribosyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A659 4.01e-53 172 43 2 212 3 upp Uracil phosphoribosyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A1SDD5 6.89e-53 171 42 1 210 3 upp Uracil phosphoribosyltransferase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8FRQ5 1.3e-52 171 42 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A1R2Y2 2.05e-52 170 42 3 213 3 upp Uracil phosphoribosyltransferase Paenarthrobacter aurescens (strain TC1)
P58998 2.31e-52 170 42 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QC29 2.31e-52 170 42 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium glutamicum (strain R)
C4LKC1 8.14e-52 169 41 3 213 3 upp Uracil phosphoribosyltransferase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
Q4JTK4 2.84e-51 167 40 2 209 3 upp Uracil phosphoribosyltransferase Corynebacterium jeikeium (strain K411)
P47276 4.35e-51 167 37 1 206 3 upp Uracil phosphoribosyltransferase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q73UD7 1.75e-50 167 41 2 210 3 upp Uracil phosphoribosyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q6NIX4 2.12e-50 165 39 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B1VF60 3.86e-50 164 40 2 209 3 upp Uracil phosphoribosyltransferase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
P75081 1.38e-49 163 37 1 206 3 upp Uracil phosphoribosyltransferase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
C3PLD0 1.4e-49 163 41 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
A9WLN5 1.5e-49 163 41 1 208 3 upp Uracil phosphoribosyltransferase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
O67914 2.84e-49 162 36 1 204 1 upp Uracil phosphoribosyltransferase Aquifex aeolicus (strain VF5)
Q5Z187 3.85e-48 159 41 1 208 3 upp Uracil phosphoribosyltransferase Nocardia farcinica (strain IFM 10152)
B3DPH5 2.22e-47 157 38 2 210 3 upp Uracil phosphoribosyltransferase Bifidobacterium longum (strain DJO10A)
Q98QP6 2.46e-47 157 40 1 204 3 upp Uracil phosphoribosyltransferase Mycoplasmopsis pulmonis (strain UAB CTIP)
A0ZZM2 3.04e-47 157 40 3 210 3 upp Uracil phosphoribosyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
B8DVI9 9.28e-47 156 38 2 210 3 upp Uracil phosphoribosyltransferase Bifidobacterium animalis subsp. lactis (strain AD011)
B1MFZ1 1e-46 156 38 4 218 3 upp Uracil phosphoribosyltransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A5IYF5 1.22e-46 155 41 1 202 3 upp Uracil phosphoribosyltransferase Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
B7GNR5 4.47e-46 154 38 3 210 3 upp Uracil phosphoribosyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
P72753 3.99e-45 152 40 6 224 3 upp Uracil phosphoribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8YVB5 5.71e-45 151 40 6 218 3 upp Uracil phosphoribosyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9M336 8.32e-43 148 39 4 213 1 UPP Uracil phosphoribosyltransferase, chloroplastic Arabidopsis thaliana
P93394 4.67e-42 144 38 4 212 2 UPP Uracil phosphoribosyltransferase Nicotiana tabacum
B6YTB2 2.47e-35 127 33 4 206 3 upp Uracil phosphoribosyltransferase Thermococcus onnurineus (strain NA1)
Q5JGQ6 2.55e-34 124 34 3 201 3 upp Uracil phosphoribosyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9US43 1.18e-33 122 30 3 205 3 urg2 Putative uracil phosphoribosyltransferase urg2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O13867 1.47e-32 120 44 1 141 3 SPAC1B3.01c Uracil phosphoribosyltransferase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
C3N7P3 1.69e-31 117 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NFT0 1.69e-31 117 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MY92 1.69e-31 117 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MRJ6 1.69e-31 117 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3MZM1 1.69e-31 117 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain M.16.27)
C4KIV1 2.09e-31 117 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
A6USD4 6.72e-31 115 33 5 209 3 upp Uracil phosphoribosyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q8U1G7 8.78e-31 115 32 3 201 3 upp Uracil phosphoribosyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A4WMQ7 1.77e-30 114 33 4 213 3 upp Uracil phosphoribosyltransferase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q980Q4 1.96e-30 114 31 5 219 1 upp Uracil phosphoribosyltransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q5UZD3 1.61e-29 112 32 5 217 3 upp Uracil phosphoribosyltransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
C5A6P6 1.9e-29 112 31 4 207 3 upp Uracil phosphoribosyltransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q3ISU0 2.42e-29 111 33 4 212 3 upp Uracil phosphoribosyltransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q8ZWV9 5.15e-29 110 32 3 211 3 upp Uracil phosphoribosyltransferase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q6LZE9 9.48e-29 110 31 4 210 3 upp Uracil phosphoribosyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q9V0K1 9.8e-29 110 32 4 206 3 upp Uracil phosphoribosyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
A1RV13 1.25e-28 109 31 4 213 3 upp Uracil phosphoribosyltransferase Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
C6A3U9 1.98e-28 109 31 3 201 3 upp Uracil phosphoribosyltransferase Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q975Z7 1.99e-28 109 28 5 223 3 upp Uracil phosphoribosyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A4YCQ1 2.59e-28 108 31 3 216 3 upp Uracil phosphoribosyltransferase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
A6VJY4 2.99e-28 108 31 3 205 3 upp Uracil phosphoribosyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q9HN05 3.13e-28 108 33 5 215 3 upp Uracil phosphoribosyltransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R7K0 3.13e-28 108 33 5 215 3 upp Uracil phosphoribosyltransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q4JAV0 3.21e-28 108 30 4 220 3 upp Uracil phosphoribosyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
A9A7A5 9.97e-28 107 32 4 188 3 upp Uracil phosphoribosyltransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
B9LUM1 1.25e-27 107 32 5 217 3 upp Uracil phosphoribosyltransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q18DK8 2.41e-27 106 33 5 218 3 upp Uracil phosphoribosyltransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q26998 2.75e-27 107 33 3 202 1 uprt Uracil phosphoribosyltransferase Toxoplasma gondii
A4FYB9 3.18e-27 106 30 4 210 3 upp Uracil phosphoribosyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
P18562 3.94e-25 100 33 4 207 1 FUR1 Uracil phosphoribosyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q55GQ6 9.21e-25 99 33 1 194 3 uprt Uracil phosphoribosyltransferase Dictyostelium discoideum
O27186 8.43e-24 97 29 7 211 3 upp Uracil phosphoribosyltransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P0C939 2.43e-23 95 31 7 210 3 upp Uracil phosphoribosyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RIV3 2.43e-23 95 31 7 210 3 upp Uracil phosphoribosyltransferase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q9YEN3 2.79e-22 93 29 2 210 3 upp Uracil phosphoribosyltransferase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03070
Feature type CDS
Gene upp
Product uracil phosphoribosyltransferase
Location 656694 - 657320 (strand: 1)
Length 627 (nucleotides) / 208 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2196
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF14681 Uracil phosphoribosyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0035 Nucleotide transport and metabolism (F) F Uracil phosphoribosyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00761 uracil phosphoribosyltransferase [EC:2.4.2.9] Pyrimidine metabolism
Metabolic pathways
Nucleotide metabolism		 -

Protein Sequence

MKVTEVKHPLVKHKLGLMRDHDISTKRFRELASEVGSLLTYEATSDLETETVTIEGWCGPVEIEQIKGKKITVVPILRAGIGMMNGVLESIPSARISVVGVYRDEVTLEAVPYFQKLASNIEERMALVVDPMLATGGSMIATIDLLKKAGCTAIKILVLVAAPEGLKALEKAHPDVELYTASVDDHLNEHGYIVPGLGDAGDKIFGTK

Flanking regions ( +/- flanking 50bp)

ATAATCTCGCGATTTTTTTGTCCGCCAGGGCTTACACAGTAGGAGATCCCATGAAAGTCACCGAGGTTAAACACCCGCTCGTTAAACACAAACTTGGCCTGATGCGAGATCATGATATAAGCACAAAGCGCTTTCGTGAACTGGCCTCAGAAGTCGGTAGCCTGCTGACCTATGAAGCAACTTCAGACTTAGAAACTGAGACAGTGACCATTGAGGGCTGGTGTGGTCCGGTCGAAATCGAACAAATTAAGGGTAAAAAAATTACCGTTGTGCCAATCCTGCGCGCAGGTATTGGTATGATGAATGGTGTGCTGGAAAGTATTCCGAGCGCACGCATCAGTGTTGTCGGTGTTTATCGTGATGAAGTCACGTTAGAAGCTGTGCCGTACTTCCAGAAATTAGCCTCTAATATTGAAGAGCGCATGGCGCTGGTGGTTGACCCGATGCTGGCAACCGGCGGTTCTATGATTGCCACGATTGACCTGCTGAAAAAAGCCGGCTGTACCGCAATTAAAATTCTGGTGTTGGTTGCGGCACCGGAAGGGCTGAAAGCGCTGGAAAAAGCACACCCGGATGTTGAGCTGTACACTGCCTCTGTTGACGATCACCTTAATGAGCACGGATACATTGTTCCGGGGCTGGGTGATGCAGGCGATAAGATATTTGGTACGAAATAATATAATGAGCCGACTTGATAGTCGGCTTTTTTTTGACATATCCCTGAGTA