Homologs in group_3044

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18180 FBDBKF_18180 82.3 Morganella morganii S1 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
EHELCC_18215 EHELCC_18215 82.3 Morganella morganii S2 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
NLDBIP_18140 NLDBIP_18140 82.3 Morganella morganii S4 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
LHKJJB_18335 LHKJJB_18335 82.3 Morganella morganii S3 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
HKOGLL_18070 HKOGLL_18070 82.3 Morganella morganii S5 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)

Distribution of the homologs in the orthogroup group_3044

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3044

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P21823 1.03e-104 327 53 3 365 3 tas Methyl-accepting chemotaxis aspartate transducer Klebsiella aerogenes (strain ATCC 13048 / DSM 30053 / CCUG 1429 / JCM 1235 / KCTC 2190 / NBRC 13534 / NCIMB 10102 / NCTC 10006 / CDC 819-56)
P05704 5.17e-99 312 45 9 448 1 trg Methyl-accepting chemotaxis protein III Escherichia coli (strain K12)
P21822 2.38e-98 311 46 7 439 3 tse Methyl-accepting chemotaxis serine transducer Klebsiella aerogenes (strain ATCC 13048 / DSM 30053 / CCUG 1429 / JCM 1235 / KCTC 2190 / NBRC 13534 / NCIMB 10102 / NCTC 10006 / CDC 819-56)
P07017 3.13e-98 310 58 1 306 1 tar Methyl-accepting chemotaxis protein II Escherichia coli (strain K12)
P02941 6.4e-98 310 59 1 299 1 tar Methyl-accepting chemotaxis protein II Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q02755 9.36e-95 301 55 1 300 3 tcp Methyl-accepting chemotaxis citrate transducer Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P02942 5.34e-88 283 55 3 299 1 tsr Methyl-accepting chemotaxis protein I Escherichia coli (strain K12)
P07018 9.85e-85 275 52 1 303 1 tap Methyl-accepting chemotaxis protein IV Escherichia coli (strain K12)
Q9I6V6 5.28e-75 253 51 1 306 1 mcpB Methyl-accepting chemotaxis protein McpB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q00986 4.47e-56 201 42 1 291 3 mcpA Chemoreceptor McpA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P50466 1.2e-52 189 37 2 315 1 aer Aerotaxis receptor Escherichia coli (strain K12)
Q02929 7.94e-51 185 32 6 399 3 Cthe_0039 Putative sensory transducer protein Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P55439 2.28e-41 162 40 0 255 3 NGR_a03800 Probable chemoreceptor y4fA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q88D09 5.06e-33 136 32 6 334 1 mcpQ Methyl-accepting chemotaxis protein McpQ Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P55652 8.46e-32 133 37 0 255 3 NGR_a01640 Probable chemoreceptor y4sI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9X0M7 2.44e-29 124 29 14 403 1 mcp2 Methyl-accepting chemotaxis protein 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5W2C8 7.84e-28 120 30 7 358 2 pcaY Methyl-accepting chemotaxis protein PcaY Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88JK6 1.74e-27 119 31 8 367 1 pcaY Methyl-accepting chemotaxis protein PcaY Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q882Z2 4.69e-27 118 29 6 340 3 pscA Methyl-accepting chemotaxis protein PscA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88E10 8.73e-27 117 33 8 335 1 mcpS Methyl-accepting chemotaxis protein McpS Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HW93 4.3e-26 115 29 9 367 1 pctC Methyl-accepting chemotaxis protein PctC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
G3XD24 6.02e-26 115 28 9 369 1 pctA Methyl-accepting chemotaxis protein PctA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HUB1 8.75e-26 114 30 5 352 1 mcpK Methyl-accepting chemotaxis protein McpK Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HW91 2.81e-25 113 28 11 369 1 pctB Methyl-accepting chemotaxis protein PctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88KP1 4.78e-25 112 30 10 365 1 mcpA Methyl-accepting chemotaxis protein McpA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P39215 1.14e-24 111 27 8 355 1 mcpB Methyl-accepting chemotaxis protein McpB Bacillus subtilis (strain 168)
P39214 1.62e-24 111 34 5 249 1 mcpA Methyl-accepting chemotaxis protein McpA Bacillus subtilis (strain 168)
P39217 1.78e-24 110 26 6 356 3 tlpB Methyl-accepting chemotaxis protein TlpB Bacillus subtilis (strain 168)
Q9X1E2 6.11e-24 108 26 12 401 1 mcp4 Methyl-accepting chemotaxis protein 4 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9Z429 9.68e-24 108 30 7 341 3 nahY Methyl-accepting chemotaxis protein NahY Pseudomonas putida
P39216 1.81e-23 107 26 9 386 3 tlpA Methyl-accepting chemotaxis protein TlpA Bacillus subtilis (strain 168)
O32239 2.15e-23 107 26 9 378 3 yvaQ Putative sensory transducer protein YvaQ Bacillus subtilis (strain 168)
G3XDA3 1.05e-22 105 27 7 381 1 ctpH Methyl-accepting chemotaxis protein CtpH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42257 3.17e-22 103 28 2 283 1 pilJ Protein PilJ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q52877 6.27e-22 102 36 3 209 3 mcpE Probable chemoreceptor McpE Rhizobium meliloti (strain 1021)
B0R9Z1 6.27e-22 102 35 2 234 1 car Transducer protein Car Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q88IY8 1.69e-21 101 27 5 341 1 mcpP Methyl-accepting chemotaxis protein McpP Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I0I4 2.41e-21 101 29 9 356 1 tlpQ Methyl-accepting chemotaxis protein TlpQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9WYR0 3.42e-21 100 26 10 385 1 mcp1 Methyl-accepting chemotaxis protein 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q88N45 4.22e-21 100 26 7 335 1 mcpG Methyl-accepting chemotaxis protein McpG Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P39209 5.11e-21 100 28 8 326 3 tlpC Methyl-accepting chemotaxis protein TlpC Bacillus subtilis (strain 168)
Q6HNQ4 2.87e-20 97 25 5 335 3 BT9727_0469 Probable methyl-accepting chemotaxis protein BT9727_0469 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q9I3F6 3.03e-20 97 31 3 244 1 aer Methyl-accepting chemotaxis protein Aer Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P35841 3.69e-20 97 30 4 263 3 dcrA Chemoreceptor protein A Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q55445 3.91e-20 98 29 3 255 3 sll0041 Putative methyl-accepting chemotaxis protein sll0041 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0VTI9 8.17e-20 96 27 5 373 3 ABO_0106 Putative methyl-accepting chemotaxis AlkN Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P15492 2.41e-19 94 26 17 457 3 hlyB Methyl-accepting chemotaxis protein HlyB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q88R14 4.4e-19 94 27 5 330 1 mcpH Methyl-accepting chemotaxis protein McpH Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5V5V4 4.75e-19 94 26 6 341 2 htr2 Sensory rhodopsin II transducer Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
C0SP89 5.87e-19 93 25 11 390 2 yoaH Putative methyl-accepting chemotaxis protein YoaH Bacillus subtilis (strain 168)
Q9X0N0 6.26e-19 93 25 8 383 1 mcp3 Methyl-accepting chemotaxis protein 3 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P43500 7.72e-19 92 28 3 296 1 frzCD Frizzy aggregation protein FrzCD Myxococcus xanthus
Q2W8M7 1.24e-18 92 34 2 224 1 amb0994 Methyl-accepting chemotaxis protein Amb0994 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9HP81 3.1e-18 92 30 8 330 3 htr2 Sensory rhodopsin II transducer Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6B1 3.1e-18 92 30 8 330 1 htr2 Sensory rhodopsin II transducer Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9HPR6 5.07e-18 90 35 5 204 3 hemAT Heme-based aerotactic transducer HemAT Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q2W4T8 6.16e-18 90 36 2 177 1 amb2333 Methyl-accepting chemotaxis protein Amb2333 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P42258 1.04e-17 89 26 6 341 3 htrII Sensory rhodopsin II transducer (Fragment) Haloarcula vallismortis
B0R474 1.89e-17 89 27 7 304 1 htr18 Transducer protein Htr18 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9I055 2.16e-17 88 30 7 268 1 mcpN Methyl-accepting chemotaxis protein McpN Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54576 2.51e-17 89 25 6 324 1 mcpC Methyl-accepting chemotaxis protein McpC Bacillus subtilis (strain 168)
P0DMI3 2.74e-17 88 28 12 356 1 htr1 Sensory rhodopsin I transducer Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R632 2.74e-17 88 28 12 356 1 htr1 Sensory rhodopsin I transducer Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P0DMI5 3.16e-17 88 31 4 290 3 htr7 Transducer protein Htr7 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6A6 3.16e-17 88 31 4 290 1 htr7 Transducer protein Htr7 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q88NI1 5.78e-17 87 28 12 373 1 mcpU Methyl-accepting chemotaxis protein McpU Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HUW6 1.23e-16 86 26 4 299 1 ctpL Methyl-accepting chemotaxis protein CtpL Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HP84 2.96e-16 85 30 2 205 3 cosT Transducer protein CosT Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6A7 2.96e-16 85 30 2 205 1 cosT Transducer protein CosT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q5UXM8 3.07e-16 85 29 11 343 1 htr1 Sensory rhodopsin I transducer Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
B0R367 3.62e-16 85 28 5 280 1 mpcT Transducer protein MpcT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P42259 8.84e-16 83 28 6 272 1 htr2 Sensory rhodopsin II transducer Natronomonas pharaonis
B0R5T0 9.47e-16 84 29 2 237 1 htr8 Transducer protein Htr8 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P0DMI4 1.94e-15 83 27 6 314 3 htr4 Transducer protein Htr4 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R470 1.94e-15 83 27 6 314 1 htr4 Transducer protein Htr4 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B0R6I4 5.15e-15 81 29 8 296 1 basT Transducer protein BasT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9I0I6 1.44e-14 80 29 11 348 1 ctpM Methyl-accepting chemotaxis protein CtpM Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I3S1 1.88e-14 79 33 2 169 1 bdlA Biofilm dispersion protein BdlA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0R4N9 1.36e-13 76 33 2 168 1 htr13 Transducer protein Htr13 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9R9U8 3.47e-13 75 26 3 247 3 alkN Putative methyl-accepting chemotaxis AlkN Pseudomonas oleovorans
A5F389 4.59e-13 75 32 6 187 3 tcpI Toxin coregulated pilus biosynthesis protein I Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0C6D8 5.37e-13 75 32 6 187 3 tcpI Toxin coregulated pilus biosynthesis protein I Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0R461 7.31e-13 75 25 7 347 1 htr6 Transducer protein Htr6 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q6HP15 9.17e-13 74 24 7 319 3 BT9727_0355 Probable methyl-accepting chemotaxis protein BT9727_0355 Bacillus thuringiensis subsp. konkukian (strain 97-27)
O07621 1.62e-12 73 37 2 116 1 hemAT Heme-based aerotactic transducer HemAT Bacillus subtilis (strain 168)
Q9HQ00 2.53e-12 72 28 4 295 3 htr9 Halobacterial transducer protein 9 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
O06477 1.03e-10 66 29 5 172 2 yfmS Putative sensory transducer protein YfmS Bacillus subtilis (strain 168)
Q9I6V2 5.35e-09 62 45 0 75 1 mcpA Methyl-accepting chemotaxis protein McpA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01725
Feature type CDS
Gene -
Product methyl-accepting chemotaxis protein
Location 382163 - 383722 (strand: 1)
Length 1560 (nucleotides) / 519 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3044
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00015 Methyl-accepting chemotaxis protein (MCP) signalling domain
PF02203 Tar ligand binding domain homologue

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0840 Signal transduction mechanisms (T) T Methyl-accepting chemotaxis protein (MCP)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03406 methyl-accepting chemotaxis protein Two-component system
Bacterial chemotaxis		 -

Protein Sequence

MWILRNFSIRFVMLSILGILCLTLGCVSFYSDWSLSRVSAGNMTDRQLVTQLTVLNQGNDQYFRFVSRLNREMERKAEGEIPDFTQSEQALKNMEQRLIQMKEISPGPMDPQVSEHIIALWQALLDEGIKVQMQLAVQGDIAAYRNQSHNVTPKLSRDFGVATEEYTQIADAHIEKTRLLVDELMSTTRIVIIAGTLFGLLVLIFSDRYLVIMMQRPLMSVRRHFRRIAGGDLSQQVDSETAGRNCVGKLFPLLSEMQVSLRDAVHSIREGSDTLRDNAAEIARGNTDLSSRTEQQAAALEQTAASMEEITATVKLNADNAAHASELAEVTSSTAHQGHEMIASVIRTMDDISDSSRKIAEITSVINSIAFQTNILALNASIEAARAGVHGRGFMVVAGEVRNLASSSADAAKEIERLIANAVSRVDQGIELVASGGETMEAIVRATTEVTSIMKEIAVASDEQTKGILQVGTAITQMDTVTQQNAALVAKVSETAAGLERQTQTLQNSVERFRLTATD

Flanking regions ( +/- flanking 50bp)

GATCTGTATAGCTTCTTCAGATCATTTTATCGCCCCGTAAAGGAAATTGTATGTGGATACTTCGAAATTTTTCCATCCGGTTCGTCATGTTGTCGATACTCGGTATTTTGTGCCTGACATTAGGATGCGTAAGTTTTTACAGTGACTGGTCGCTGTCGAGAGTATCTGCAGGTAATATGACGGATCGCCAGTTAGTCACACAACTGACTGTGTTGAATCAGGGAAATGATCAGTATTTCCGGTTTGTCTCCAGGTTAAATCGTGAGATGGAAAGAAAAGCAGAAGGCGAGATTCCTGATTTTACGCAATCAGAGCAGGCGCTGAAAAATATGGAACAGCGCCTGATACAGATGAAAGAGATATCACCCGGACCTATGGATCCGCAAGTGTCTGAACATATTATTGCCCTCTGGCAGGCTCTGCTTGATGAGGGTATTAAAGTGCAGATGCAGCTGGCTGTGCAGGGCGATATCGCTGCATACCGCAATCAGTCCCATAATGTGACACCGAAACTGAGCCGGGATTTTGGTGTGGCAACAGAGGAATATACGCAGATAGCAGATGCTCATATAGAAAAGACCCGCCTGCTGGTGGATGAACTGATGTCAACCACACGGATAGTGATTATTGCCGGGACACTTTTCGGTCTTCTGGTGCTGATTTTTTCCGACAGATATCTTGTTATTATGATGCAGCGCCCACTGATGAGTGTGCGCCGGCATTTTCGCCGCATAGCCGGTGGCGACCTCAGTCAGCAGGTGGACAGTGAGACAGCCGGTCGCAACTGTGTGGGCAAACTGTTTCCGTTGCTCAGTGAGATGCAGGTAAGTCTGCGCGATGCTGTCCATTCTATCCGTGAAGGCAGTGATACTTTGAGAGATAATGCGGCTGAAATTGCGCGCGGCAATACTGATCTTTCCTCACGGACCGAACAGCAGGCTGCCGCGCTGGAACAGACGGCGGCGAGTATGGAAGAGATAACCGCCACCGTTAAACTGAATGCCGATAATGCCGCTCATGCCAGTGAACTGGCAGAAGTGACCTCATCAACGGCGCATCAGGGGCATGAGATGATAGCCTCTGTTATCCGCACAATGGATGATATTTCTGATAGTTCACGGAAAATAGCCGAAATTACCAGTGTGATTAACAGTATTGCTTTCCAGACAAATATTCTGGCACTGAATGCCTCGATTGAAGCAGCAAGAGCGGGTGTTCACGGGCGCGGCTTTATGGTGGTCGCCGGAGAAGTGCGTAATCTTGCCAGCAGCAGTGCAGATGCGGCAAAAGAGATTGAGCGGCTGATAGCCAATGCGGTTTCCCGTGTTGATCAGGGGATTGAGTTAGTTGCCAGTGGTGGCGAAACGATGGAAGCGATAGTCAGAGCAACAACCGAAGTGACCTCGATTATGAAAGAGATTGCAGTTGCCTCAGATGAGCAAACCAAGGGAATATTACAGGTCGGAACAGCTATCACTCAGATGGATACCGTCACACAGCAAAATGCGGCACTGGTCGCAAAAGTATCTGAAACCGCAGCAGGGCTGGAGCGCCAGACTCAGACGTTGCAGAACTCAGTTGAGAGATTTCGTCTTACCGCCACTGACTGATTGACGGCGTTATAATTATTACCGGCAGGTATGCGAGCAAAAAATGGGGT