Homologs in group_2716

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06935 FBDBKF_06935 100.0 Morganella morganii S1 - his operon leader peptide
EHELCC_04035 EHELCC_04035 100.0 Morganella morganii S2 - his operon leader peptide
NLDBIP_04035 NLDBIP_04035 100.0 Morganella morganii S4 - his operon leader peptide
LHKJJB_09865 LHKJJB_09865 100.0 Morganella morganii S3 - his operon leader peptide
HKOGLL_09110 HKOGLL_09110 100.0 Morganella morganii S5 - his operon leader peptide

Distribution of the homologs in the orthogroup group_2716

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2716

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01120
Feature type CDS
Gene hisL
Product his operon leader peptide
Location 236769 - 236816 (strand: -1)
Length 48 (nucleotides) / 15 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2716
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF08047 Histidine operon leader peptide

Protein Sequence

MTRIQFSHHHHHHPD

Flanking regions ( +/- flanking 50bp)

CATAGCAATAGTATTCATGATGACAACTAAATCAACAGTGAGAGATTACCATGACACGCATTCAGTTCAGCCATCACCATCACCATCATCCTGACTAGTCTTTCAGGCAATTGGTGCTGGAAGACTATGTAAAGTCTTCCGGTGGCAT