Homologs in group_327

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09885 FBDBKF_09885 83.4 Morganella morganii S1 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxy late synthase MenH and related esterases, alpha/beta hydrolase fold
EHELCC_04685 EHELCC_04685 83.4 Morganella morganii S2 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxy late synthase MenH and related esterases, alpha/beta hydrolase fold
NLDBIP_04685 NLDBIP_04685 83.4 Morganella morganii S4 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxy late synthase MenH and related esterases, alpha/beta hydrolase fold
LHKJJB_13945 LHKJJB_13945 83.4 Morganella morganii S3 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxy late synthase MenH and related esterases, alpha/beta hydrolase fold
HKOGLL_12590 HKOGLL_12590 83.4 Morganella morganii S5 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxy late synthase MenH and related esterases, alpha/beta hydrolase fold
F4V73_RS12505 F4V73_RS12505 28.4 Morganella psychrotolerans - alpha/beta hydrolase
PMI_RS02690 PMI_RS02690 61.4 Proteus mirabilis HI4320 ybfF esterase

Distribution of the homologs in the orthogroup group_327

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_327

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P75736 2.41e-101 298 56 0 245 1 ybfF Esterase YbfF Escherichia coli (strain K12)
Q57427 5.92e-75 232 45 5 259 3 HI_0193 Putative esterase/lipase HI_0193 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0V9K2 1.17e-39 142 33 7 266 2 abhd11 sn-1-specific diacylglycerol lipase ABHD11 Xenopus tropicalis
Q8NFV4 1.66e-39 142 33 6 265 1 ABHD11 sn-1-specific diacylglycerol lipase ABHD11 Homo sapiens
Q8K4F5 4.38e-39 140 34 6 249 1 Abhd11 sn-1-specific diacylglycerol lipase ABHD11 Mus musculus
Q2TAP9 7.6e-39 140 34 6 252 2 abhd11 sn-1-specific diacylglycerol lipase ABHD11 Xenopus laevis
Q6DRD9 1.09e-38 140 33 6 266 2 abhd11 sn-1-specific diacylglycerol lipase ABHD11 Danio rerio
Q3SZ73 1e-34 129 30 7 268 1 ABHD11 sn-1-specific diacylglycerol lipase ABHD11 Bos taurus
O94437 2.97e-27 108 29 7 268 3 SPAC22H12.03 Abhydrolase domain-containing protein C22H12.03 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P53219 1.27e-26 108 31 9 293 1 IMO32 Probable alcohol acetyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A1E4S2N7 1.58e-19 89 25 9 277 3 EAT2 Probable alcohol acetyltransferase Cyberlindnera jadinii (strain ATCC 18201 / CBS 1600 / BCRC 20928 / JCM 3617 / NBRC 0987 / NRRL Y-1542)
A0A061B0Q2 1.65e-18 86 23 8 270 1 EAT1 Ethanol acetyltransferase 1 Cyberlindnera fabianii
K0KSN3 1.12e-17 84 27 11 269 3 EAT2 Probable alcohol acetyltransferase Wickerhamomyces ciferrii (strain ATCC 14091 / BCRC 22168 / CBS 111 / JCM 3599 / NBRC 0793 / NRRL Y-1031 F-60-10)
A0A061AYY2 1.9e-17 84 25 10 281 3 EAT2 Probable alcohol acetyltransferase Cyberlindnera fabianii
K0KPV8 8.96e-17 82 25 7 275 1 EAT1 Ethanol acetyltransferase 1 Wickerhamomyces ciferrii (strain ATCC 14091 / BCRC 22168 / CBS 111 / JCM 3599 / NBRC 0793 / NRRL Y-1031 F-60-10)
A0A1E3P8S6 5.62e-16 80 25 10 275 1 EAT1 Ethanol acetyltransferase 1 Wickerhamomyces anomalus (strain ATCC 58044 / CBS 1984 / NCYC 433 / NRRL Y-366-8)
G8JVR4 1.57e-15 78 26 10 291 1 EAT1 Ethanol acetyltransferase 1 Eremothecium cymbalariae (strain CBS 270.75 / DBVPG 7215 / KCTC 17166 / NRRL Y-17582)
Q6CLY8 3.91e-15 77 25 9 278 1 EAT1 Ethanol acetyltransferase 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A0A1E5RUL9 4.03e-15 77 25 8 261 1 EAT1 Ethanol acetyltransferase 1 Hanseniaspora uvarum
A0A1E4S2P1 6.11e-15 76 25 10 268 1 EAT1 Ethanol acetyltransferase 1 Cyberlindnera jadinii (strain ATCC 18201 / CBS 1600 / BCRC 20928 / JCM 3617 / NBRC 0987 / NRRL Y-1542)
A0A1E3P8S8 1.02e-14 75 24 8 270 3 EAT2 Probable alcohol acetyltransferase Wickerhamomyces anomalus (strain ATCC 58044 / CBS 1984 / NCYC 433 / NRRL Y-366-8)
W0T4A7 1.15e-14 75 24 9 292 1 EAT1 Ethanol acetyltransferase 1 Kluyveromyces marxianus (strain DMKU3-1042 / BCC 29191 / NBRC 104275)
G5EBI4 1.78e-11 67 23 6 263 1 ceeh-1 Epoxide hydrolase 1 Caenorhabditis elegans
Q59695 4.18e-11 65 24 5 251 3 acoC Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system Pseudomonas putida
P23974 8.4e-11 64 26 12 264 3 menH Putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase Bacillus subtilis (strain 168)
Q01398 8.49e-11 64 30 1 125 1 dehH1 Haloacetate dehalogenase H-1 Moraxella sp. (strain B)
I6XU97 2.06e-10 63 24 7 259 1 Rv0045c Esterase Rv0045c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A1E5RIW9 5.75e-10 62 22 10 297 1 EAT2 Ethanol acetyltransferase 2 Hanseniaspora uvarum
Q1JU72 7.71e-10 61 29 1 124 1 fac-dex Fluoroacetate dehalogenase Burkholderia sp.
P27747 1.05e-09 61 33 5 164 1 acoC Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P07383 1.2e-09 60 25 9 252 1 None Tropinesterase Pseudomonas putida
O05235 2.24e-09 60 21 4 247 3 yugF Uncharacterized hydrolase YugF Bacillus subtilis (strain 168)
C5CN82 2.4e-09 60 34 5 138 3 rutD Putative carbamate hydrolase RutD Variovorax paradoxus (strain S110)
Q9H6B9 5.15e-09 59 22 8 262 1 EPHX3 Epoxide hydrolase 3 Homo sapiens
Q0IIS3 6.74e-09 59 24 12 278 2 ephx3 Epoxide hydrolase 3 Xenopus tropicalis
P24640 1.62e-08 57 26 7 238 1 lip3 Lipase 3 Moraxella sp. (strain TA144)
C6L862 1.93e-08 57 26 11 264 1 aiiM N-acyl homoserine lactonase Microbacterium testaceum (strain StLB037)
P53208 2.43e-08 57 34 5 104 1 EAT1 Ethanol acetyltransferase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O06734 2.55e-08 57 24 10 273 3 yisY AB hydrolase superfamily protein YisY Bacillus subtilis (strain 168)
O52866 2.99e-08 57 33 1 103 1 None Soluble epoxide hydrolase Corynebacterium sp. (strain C12)
P0A573 4.3e-08 56 32 2 113 3 BQ2027_MB2734 Uncharacterized protein Mb2734 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WNH3 4.3e-08 56 32 2 113 1 Rv2715 Uncharacterized protein Rv2715 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNH2 4.3e-08 56 32 2 113 3 MT2788 Uncharacterized protein MT2788 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P23106 5.26e-08 56 24 6 247 1 xylF 2-hydroxymuconate semialdehyde hydrolase Pseudomonas putida
Q988D4 7.53e-08 55 23 7 264 1 mlr6787 2-(acetamidomethylene)succinate hydrolase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A0A0E4AE72 1.3e-07 55 25 10 255 1 aqdC1 2-heptyl-3-hydroxy-4-quinolone dioxygenase AqdC1 Rhodococcus erythropolis
Q6IE26 1.51e-07 55 30 2 99 2 Ephx4 Epoxide hydrolase 4 Mus musculus
Q8IUS5 2.2e-07 54 29 2 99 1 EPHX4 Epoxide hydrolase 4 Homo sapiens
A2BGU9 5.81e-07 53 32 1 99 2 serhl Serine hydrolase-like protein Danio rerio
Q02104 6.02e-07 53 24 8 249 1 lip1 Lipase 1 Psychrobacter immobilis
C7CM33 7.7e-07 52 35 2 117 3 rutD Putative carbamate hydrolase RutD Methylorubrum extorquens (strain DSM 6343 / CIP 106787 / DM4)
Q8R164 1.43e-06 52 22 8 266 1 Bphl Valacyclovir hydrolase Mus musculus
Q4W8C9 1.74e-06 51 33 3 122 1 phaZc 3-hydroxybutyrate-oligomer hydrolase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B0SW62 1.92e-06 51 25 6 269 3 rutD Putative carbamate hydrolase RutD Caulobacter sp. (strain K31)
O34592 1.93e-06 51 20 4 254 2 ydjP AB hydrolase superfamily protein YdjP Bacillus subtilis (strain 168)
A8IAD8 2.53e-06 50 33 1 104 3 rutD Putative carbamate hydrolase RutD Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
L0TC47 3.24e-06 50 27 6 209 1 lipV Lipase LipV Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B1ZB18 3.81e-06 50 34 2 115 3 rutD Putative carbamate hydrolase RutD Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
P75311 3.97e-06 50 22 6 218 3 MPN_473 Putative esterase/lipase 2 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q59093 4.36e-06 50 24 5 225 4 pcaD 3-oxoadipate enol-lactonase 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B7KWT4 5.04e-06 50 35 2 115 3 rutD Putative carbamate hydrolase RutD Methylorubrum extorquens (strain CM4 / NCIMB 13688)
P96688 1.9e-05 48 25 10 250 1 nap Uncharacterized carboxylesterase nap Bacillus subtilis (strain 168)
Q9AQM4 1.99e-05 48 25 14 278 1 carC 2-hydroxy-6-oxo-6-(2'-aminophenyl)hexa-2,4-dienoic acid hydrolase Pseudomonas resinovorans
P19076 2.07e-05 48 22 5 260 3 dmpD 2-hydroxymuconate semialdehyde hydrolase Pseudomonas sp. (strain CF600)
Q9EPB5 3.04e-05 48 25 2 120 1 Serhl Serine hydrolase-like protein Mus musculus
P91143 3.93e-05 47 22 9 272 3 abhd-5.1 Abhydrolase domain-containing protein abhd-5.1 Caenorhabditis elegans
B1M5I5 4.2e-05 47 33 2 113 3 rutD Putative carbamate hydrolase RutD Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
O31581 4.21e-05 47 31 4 103 3 yfhM AB hydrolase superfamily protein YfhM Bacillus subtilis (strain 168)
O07015 4.44e-05 47 24 7 233 1 rsbQ Sigma factor SigB regulation protein RsbQ Bacillus subtilis (strain 168)
D5CE35 4.59e-05 47 30 1 107 3 rutD Putative carbamate hydrolase RutD Enterobacter cloacae subsp. cloacae (strain ATCC 13047 / DSM 30054 / NBRC 13535 / NCTC 10005 / WDCM 00083 / NCDC 279-56)
D5VGV3 4.92e-05 47 34 1 98 3 rutD Putative carbamate hydrolase RutD Caulobacter segnis (strain ATCC 21756 / DSM 7131 / JCM 7823 / NBRC 15250 / LMG 17158 / TK0059)
O32234 5.57e-05 47 25 8 206 2 yvaM AB hydrolase superfamily protein YvaM Bacillus subtilis (strain 168)
Q54M29 6.08e-05 47 25 4 124 3 DDB_G0286239 Serine hydrolase-like protein DDB_G0286239 Dictyostelium discoideum
A1JMX1 7.1e-05 46 31 3 119 3 rutD Putative carbamate hydrolase RutD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7MTF2 9.52e-05 46 33 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O81 (strain ED1a)
Q5EA59 0.000103 46 28 6 125 2 ABHD4 (Lyso)-N-acylphosphatidylethanolamine lipase Bos taurus
P9WNH5 0.000124 46 25 10 239 1 hsaD 4,5:9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNH4 0.000124 46 25 10 239 3 hsaD 4,5:9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A4WCP8 0.00014 45 27 1 93 3 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase Enterobacter sp. (strain 638)
Q8FJ43 0.000141 45 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q86WA6 0.000148 45 22 7 257 1 BPHL Valacyclovir hydrolase Homo sapiens
Q4FZT2 0.000159 45 23 10 273 1 Ppme1 Protein phosphatase methylesterase 1 Rattus norvegicus
Q0TJ58 0.00017 45 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UNZ2 0.000176 45 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LIZ6 0.000178 45 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain SMS-3-5 / SECEC)
Q8BVQ5 0.000186 45 23 10 273 1 Ppme1 Protein phosphatase methylesterase 1 Mus musculus
D2NGI6 0.000186 45 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O150:H5 (strain SE15)
O18391 0.000204 45 28 2 119 2 kraken Probable serine hydrolase Drosophila melanogaster
B7NLB7 0.00021 45 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
H2KZ86 0.000226 45 29 2 107 1 abhd-5.2 Abhydrolase domain-containing protein abhd-5.2 Caenorhabditis elegans
Q8VD66 0.000229 45 25 14 272 1 Abhd4 (Lyso)-N-acylphosphatidylethanolamine lipase Mus musculus
Q5F641 0.000271 44 32 1 100 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B1IV88 0.000272 45 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYW4 0.000272 45 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O9:H4 (strain HS)
A9MMB5 0.000278 44 23 6 242 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C8U5H1 0.000285 45 31 3 112 2 rutD Putative carbamate hydrolase RutD Escherichia coli O103:H2 (strain 12009 / EHEC)
P9WNH1 0.000293 44 26 9 233 1 bpoC Putative non-heme bromoperoxidase BpoC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNH0 0.000293 44 26 9 233 3 bpoC Putative non-heme bromoperoxidase BpoC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q83LK8 0.000342 44 33 3 101 3 rutD Putative carbamate hydrolase RutD Shigella flexneri
D2AC40 0.000342 44 33 3 101 3 rutD Putative carbamate hydrolase RutD Shigella flexneri serotype X (strain 2002017)
Q0T625 0.000345 44 33 3 101 3 rutD Putative carbamate hydrolase RutD Shigella flexneri serotype 5b (strain 8401)
Q32HQ2 0.000348 44 32 3 112 3 rutD Putative carbamate hydrolase RutD Shigella dysenteriae serotype 1 (strain Sd197)
D5CZG9 0.000351 44 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O18:K1:H7 (strain IHE3034 / ExPEC)
A1A9R4 0.000351 44 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O1:K1 / APEC
B7MIF6 0.000351 44 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O45:K1 (strain S88 / ExPEC)
Q1RDK8 0.00036 44 32 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain UTI89 / UPEC)
P26174 0.000526 44 34 1 87 3 bchO Magnesium-chelatase 30 kDa subunit Rhodobacter capsulatus
Q32AM6 0.00058 43 30 3 121 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shigella dysenteriae serotype 1 (strain Sd197)
A8GCT3 0.000647 43 34 1 67 3 rutD Putative carbamate hydrolase RutD Serratia proteamaculans (strain 568)
B6I985 0.000693 43 31 3 112 1 rutD Putative carbamate hydrolase RutD Escherichia coli (strain SE11)
P75895 0.000693 43 31 3 112 1 rutD Putative carbamate hydrolase RutD Escherichia coli (strain K12)
B1X9D0 0.000693 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain K12 / DH10B)
C9QZ67 0.000693 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain ATCC 33849 / DSM 4235 / NCIMB 12045 / K12 / DH1)
C4ZQD7 0.000693 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain K12 / MC4100 / BW2952)
C6UFC0 0.000693 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain B / REL606)
C6EHJ8 0.000693 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain B / BL21-DE3)
C8UMM5 0.000693 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O111:H- (strain 11128 / EHEC)
B7M8Z4 0.000719 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O8 (strain IAI1)
A9W3H8 0.000742 43 36 2 115 3 rutD Putative carbamate hydrolase RutD Methylorubrum extorquens (strain PA1)
B7N3G5 0.000746 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1LHL2 0.000751 43 30 1 104 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain SMS-3-5 / SECEC)
Q3Z3A4 0.00076 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Shigella sonnei (strain Ss046)
B7LFB9 0.00076 43 31 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain 55989 / EAEC)
B7NMH7 0.000764 43 30 1 104 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q9KWQ6 0.000783 43 24 8 229 1 hsaD 4,5:9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase Rhodococcus jostii (strain RHA1)
B5YTW3 0.00083 43 30 1 104 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X716 0.00083 43 30 1 104 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O157:H7
B5XTS4 0.000889 43 26 1 112 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Klebsiella pneumoniae (strain 342)
A7ZKB4 0.001 43 30 3 112 3 rutD Putative carbamate hydrolase RutD Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7CWX3 0.001 43 36 1 63 3 rutD Putative carbamate hydrolase RutD Agrobacterium fabrum (strain C58 / ATCC 33970)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS00465
Feature type CDS
Gene -
Product alpha/beta fold hydrolase
Location 98271 - 99050 (strand: -1)
Length 780 (nucleotides) / 259 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_327
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF12697 Alpha/beta hydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0596 Coenzyme transport and metabolism (H)
General function prediction only (R)		 HR 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase MenH and related esterases, alpha/beta hydrolase fold

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01175 esterase [EC:3.1.-.-] - -

Protein Sequence

MKLPALLHYEVFTPEISQSATPVILIHGLFGDLHNLGVLGRGLRTTHTVVQIDVRNHGDSPRANTMSYAEMAQDVLDLITALAFEKVIVIGHSMGGKIAMALAALAPETVKALVVIDIAPVAYGVRRHDEIIAALEDVTDAGVTTRQAATSVMEQRIREDGVIPFLLKSFHQGEWKFNLPVIKAQYESIIGWEPLPALNVPLLLIPGGKSSYVKPEYREAIMQQFPQATAHVIAGCGHWVHAEKPDAVLRAIGRFLEKI

Flanking regions ( +/- flanking 50bp)

AGTCATGTCATCATAGCGGATATGTTTTGCTCTGCGGATCGGCTGTTATTATGAAATTACCTGCATTACTGCACTATGAAGTATTCACGCCTGAAATATCACAATCTGCCACTCCTGTTATTCTTATCCACGGGTTATTCGGTGATCTGCATAATCTGGGCGTGCTCGGGCGCGGGTTGCGCACCACACACACCGTCGTGCAGATTGATGTCCGTAACCACGGCGATTCGCCGCGTGCGAACACGATGAGTTATGCCGAAATGGCGCAGGATGTGCTTGATCTCATCACCGCACTGGCATTTGAAAAAGTCATTGTTATCGGACATTCCATGGGCGGAAAAATAGCGATGGCGCTGGCGGCACTGGCACCGGAAACGGTGAAAGCCCTTGTGGTGATTGATATAGCGCCGGTAGCTTACGGCGTGCGCCGTCATGATGAAATCATCGCTGCACTCGAAGATGTGACCGACGCGGGTGTCACAACGCGTCAGGCTGCCACATCTGTAATGGAACAGCGCATCAGAGAAGACGGGGTGATCCCGTTTCTGCTCAAATCCTTCCACCAGGGAGAATGGAAATTCAACCTGCCGGTCATAAAAGCACAGTATGAATCTATAATCGGATGGGAGCCGCTGCCCGCACTGAACGTTCCGCTGCTGCTTATCCCGGGCGGAAAATCATCCTATGTGAAACCTGAGTACCGCGAAGCTATTATGCAGCAGTTTCCGCAGGCAACCGCGCATGTGATCGCCGGATGCGGACATTGGGTTCACGCCGAAAAACCGGATGCTGTCCTGCGTGCTATCGGTCGGTTTCTGGAAAAAATCTGACAGCAAAAACAAAAATTCAGTGGCGGAAACTCACCAACAGATTTTCCGCG