Homologs in group_3802
1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| F4V73_RS18330 | F4V73_RS18330 | 46.8 | Morganella psychrotolerans | - | type II toxin-antitoxin system HigB family toxin |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| Q8FEM8 | 1.51e-34 | 117 | 46 | 0 | 103 | 3 | higB | mRNA interferase HigB | Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC) |
| P64580 | 1.62e-19 | 79 | 35 | 0 | 99 | 1 | higB | mRNA interferase HigB | Shigella flexneri |
| P64578 | 1.62e-19 | 79 | 35 | 0 | 99 | 1 | higB | mRNA interferase toxin HigB | Escherichia coli (strain K12) |
| P64579 | 1.62e-19 | 79 | 35 | 0 | 99 | 3 | higB | mRNA interferase HigB | Escherichia coli O157:H7 |
| Source | Morganella psychrotolerans |
|---|---|
| Locus tag | F4V73_RS00345 |
| Feature type | CDS |
| Gene | - |
| Product | type II toxin-antitoxin system HigB family toxin |
| Location | 79577 - 79888 (strand: 1) |
| Length | 312 (nucleotides) / 103 (amino acids) |
| Accession | term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object |
|---|---|
| Length | 2012992 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3802 | |
|---|---|---|
| Orthogroup size | 2 | |
| N. genomes | 1 |
| PF09907 | HigB_toxin, RelE-like toxic component of a toxin-antitoxin system |
|---|
| ID | Function(s) descr. | Function(s) cat. | Description |
|---|---|---|---|
| COG4680 | Translation, ribosomal structure and biogenesis (J) Defense mechanisms (V) |
JV | mRNA-degrading endonuclease (mRNA interferase) HigB, toxic component of the HigAB toxin-antitoxin module |
| KO | Description | Pathways | Modules |
|---|---|---|---|
| K19166 | mRNA interferase HigB [EC:3.1.-.-] | - | - |
MHVISREPFVLASNRFPDHAQALTDIYKILKQGVYNTPDDLKKVFPCLDRMKYRKKWWVIDIGGNSLRMIFFADFERGKIFIKHISAHAEYDKLVAYYRRTKE
ACTTGCTGCTATACTGTTGCCAAACAGGAAACAAAAATAAGAGATAAATGATGCACGTGATTTCGAGAGAGCCTTTTGTCCTTGCGTCAAACCGGTTTCCTGATCATGCTCAGGCGTTAACAGATATTTATAAAATATTAAAGCAGGGCGTCTATAACACGCCGGACGATCTGAAAAAAGTATTTCCGTGTCTGGACAGAATGAAGTACAGAAAAAAATGGTGGGTAATTGATATTGGCGGTAACTCACTGAGAATGATATTTTTTGCGGATTTTGAGCGTGGAAAAATATTTATTAAGCACATTTCTGCTCATGCAGAGTACGACAAGTTGGTCGCGTATTACCGGAGAACAAAAGAATGATTATCATTGATGCTATTCAGGCAGCAAATAACTTAATCAATATTGTCCCG
