Homologs in group_3582

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19405 FBDBKF_19405 100.0 Morganella morganii S1 - ATP-dependent Clp protease proteolytic subunit
NLDBIP_19385 NLDBIP_19385 100.0 Morganella morganii S4 - ATP-dependent Clp protease proteolytic subunit
LHKJJB_19420 LHKJJB_19420 100.0 Morganella morganii S3 - ATP-dependent Clp protease proteolytic subunit
HKOGLL_19190 HKOGLL_19190 100.0 Morganella morganii S5 - ATP-dependent Clp protease proteolytic subunit

Distribution of the homologs in the orthogroup group_3582

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3582

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A6YG63 1.64e-12 68 34 3 138 3 clpP ATP-dependent Clp protease proteolytic subunit Pleurastrum terricola
Q5SKM8 9.57e-12 65 30 2 140 1 clpP ATP-dependent Clp protease proteolytic subunit Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72L15 9.57e-12 65 30 2 140 3 clpP ATP-dependent Clp protease proteolytic subunit Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q28NI7 1.72e-10 62 25 3 162 3 clpP ATP-dependent Clp protease proteolytic subunit Jannaschia sp. (strain CCS1)
Q9RSZ7 1.72e-10 62 26 2 147 3 clpP ATP-dependent Clp protease proteolytic subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q1IWD9 2.23e-10 62 29 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q2RU45 3.58e-10 62 27 5 208 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q11J60 3.71e-10 61 26 4 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chelativorans sp. (strain BNC1)
Q82NZ4 4.54e-10 61 30 5 174 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9MUV8 7.76e-10 61 29 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Mesostigma viride
Q982V6 7.81e-10 60 25 4 192 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0AQ07 8.68e-10 60 26 1 142 3 clpP ATP-dependent Clp protease proteolytic subunit Maricaulis maris (strain MCS10)
Q1WTA8 1.08e-09 60 29 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Ligilactobacillus salivarius (strain UCC118)
Q89KG1 1.11e-09 60 27 5 205 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q20F17 1.43e-09 59 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Oltmannsiellopsis viridis
B3CLB1 1.54e-09 60 30 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q5QXN8 1.55e-09 60 29 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q15R46 3.16e-09 59 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q8YHC8 3.38e-09 58 27 5 195 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJ81 3.38e-09 58 27 5 195 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella melitensis biotype 2 (strain ATCC 23457)
B0CGR1 4.18e-09 58 27 4 192 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M5C2 4.18e-09 58 27 4 192 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9L7X6 4.18e-09 58 27 4 192 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus biovar 1 (strain 9-941)
Q2YPX1 4.18e-09 58 27 4 192 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus (strain 2308)
B2S5W1 4.18e-09 58 27 4 192 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus (strain S19)
P56317 4.34e-09 58 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorella vulgaris
Q6G178 4.99e-09 58 27 1 143 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella quintana (strain Toulouse)
Q165F9 6.62e-09 58 25 2 162 3 clpP ATP-dependent Clp protease proteolytic subunit Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q03GX1 7.63e-09 57 29 2 140 3 clpP ATP-dependent Clp protease proteolytic subunit Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q9K888 1.07e-08 57 27 2 137 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8G0I4 1.11e-08 57 26 3 188 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella suis biovar 1 (strain 1330)
Q256C2 1.22e-08 57 31 2 137 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia felis (strain Fe/C-56)
Q1GPH5 1.23e-08 57 28 1 146 3 clpP ATP-dependent Clp protease proteolytic subunit Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q5L4W7 1.3e-08 57 31 2 137 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia abortus (strain DSM 27085 / S26/3)
Q31BD5 1.45e-08 57 28 4 152 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain MIT 9312)
Q5LUQ0 1.48e-08 57 25 2 155 3 clpP ATP-dependent Clp protease proteolytic subunit Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A8WPG6 2.2e-08 57 28 1 126 3 clpp-1 ATP-dependent Clp protease proteolytic subunit 1, mitochondrial Caenorhabditis briggsae
B3R4W1 2.38e-08 56 30 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q0KBK4 2.38e-08 56 30 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1GGF6 2.47e-08 56 26 2 153 3 clpP ATP-dependent Clp protease proteolytic subunit Ruegeria sp. (strain TM1040)
Q13UT1 2.59e-08 56 28 2 143 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Paraburkholderia xenovorans (strain LB400)
Q821M0 2.76e-08 56 30 2 137 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q98M38 2.94e-08 56 27 3 156 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q27539 3.02e-08 56 26 2 136 1 clpp-1 ATP-dependent Clp protease proteolytic subunit 1, mitochondrial Caenorhabditis elegans
Q9Z759 3.04e-08 56 29 2 144 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia pneumoniae
Q2G3T3 3.18e-08 56 29 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q11I48 3.24e-08 56 27 2 144 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chelativorans sp. (strain BNC1)
A8LJA8 3.27e-08 56 25 2 157 3 clpP ATP-dependent Clp protease proteolytic subunit Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q1MK43 3.52e-08 55 28 3 157 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q215J2 3.52e-08 56 27 5 202 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisB18)
Q9X7R9 3.64e-08 56 28 4 174 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B9KJU9 3.73e-08 56 26 2 155 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J1G6 3.73e-08 56 26 2 155 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PKS1 3.73e-08 56 26 2 155 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q19VC3 3.75e-08 56 29 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorokybus atmophyticus
Q5L6P3 3.9e-08 55 28 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia abortus (strain DSM 27085 / S26/3)
Q6G3Z3 4.18e-08 55 25 3 198 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A6SY74 4.83e-08 55 26 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Janthinobacterium sp. (strain Marseille)
Q2KHU4 5.58e-08 56 27 2 163 2 CLPP ATP-dependent Clp protease proteolytic subunit, mitochondrial Bos taurus
A1K783 5.76e-08 55 27 3 159 3 clpP ATP-dependent Clp protease proteolytic subunit Azoarcus sp. (strain BH72)
B6JGU7 5.79e-08 55 26 5 204 3 clpP ATP-dependent Clp protease proteolytic subunit Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B2G613 5.91e-08 55 27 2 135 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VII4 5.91e-08 55 27 2 135 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus reuteri (strain DSM 20016)
A8HYF2 6.49e-08 55 26 5 194 3 clpP ATP-dependent Clp protease proteolytic subunit Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q46L44 7.35e-08 55 29 5 162 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain NATL2A)
P58278 7.61e-08 55 25 2 140 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium meliloti (strain 1021)
Q94B60 7.92e-08 55 28 2 141 1 CLPP4 ATP-dependent Clp protease proteolytic subunit 4, chloroplastic Arabidopsis thaliana
Q8UFY6 8.33e-08 55 25 1 135 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q07NN6 8.34e-08 55 27 4 190 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisA53)
B2GAL4 8.49e-08 54 26 2 135 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B8IYM2 8.56e-08 55 29 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A4WSH8 8.57e-08 55 26 2 155 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q472D3 8.58e-08 55 29 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1QL76 1e-07 54 27 5 204 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q2KAB9 1.02e-07 54 28 2 152 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O88696 1.07e-07 55 27 2 163 1 Clpp ATP-dependent Clp protease proteolytic subunit, mitochondrial Mus musculus
Q8DJZ9 1.12e-07 54 27 1 133 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O84712 1.12e-07 54 29 2 137 1 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KKY8 1.12e-07 54 29 2 137 1 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0SZQ2 1.27e-07 54 25 3 163 3 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter sp. (strain K31)
A4QLL9 1.43e-07 54 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Lobularia maritima
A4QKL7 1.43e-07 54 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Capsella bursa-pastoris
Q1BH85 1.44e-07 54 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia orbicola (strain AU 1054)
Q0BEF6 1.44e-07 54 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K847 1.44e-07 54 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia cenocepacia (strain HI2424)
Q3A3X5 1.5e-07 53 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B3Q7P5 1.51e-07 54 27 4 190 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain TIE-1)
Q6N5L3 1.51e-07 54 27 4 190 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A7ILC6 1.64e-07 54 25 5 201 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q8D346 1.68e-07 53 25 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Wigglesworthia glossinidia brevipalpis
Q39FE8 1.69e-07 54 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
C0R2W3 1.75e-07 53 29 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia sp. subsp. Drosophila simulans (strain wRi)
A9ISA4 1.77e-07 53 25 4 203 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella tribocorum (strain CIP 105476 / IBS 506)
P58276 1.9e-07 53 27 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q1LM62 1.95e-07 53 29 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A4JF05 1.95e-07 53 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0SMP6 2.08e-07 53 27 2 140 3 clpP ATP-dependent Clp protease proteolytic subunit Borreliella afzelii (strain PKo)
Q16740 2.08e-07 54 27 2 163 1 CLPP ATP-dependent Clp protease proteolytic subunit, mitochondrial Homo sapiens
B8GX16 2.12e-07 53 26 3 164 1 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAU1 2.12e-07 53 26 3 164 3 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9PLM0 2.19e-07 53 29 2 137 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia muridarum (strain MoPn / Nigg)
Q2L256 2.27e-07 53 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella avium (strain 197N)
P30063 2.28e-07 53 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Epifagus virginiana
A5EKA8 2.59e-07 53 26 5 202 3 clpP ATP-dependent Clp protease proteolytic subunit Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q2IWZ4 2.6e-07 53 27 4 190 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain HaA2)
Q09WZ2 2.66e-07 53 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Morus indica
A7M988 2.67e-07 53 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Cuscuta reflexa
Q73M38 2.77e-07 53 24 3 190 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7VC22 2.79e-07 53 29 5 155 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q0SGJ7 3.06e-07 53 28 2 138 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Rhodococcus jostii (strain RHA1)
A1E9U9 3.28e-07 53 26 4 149 3 clpP ATP-dependent Clp protease proteolytic subunit Sorghum bicolor
Q6ENT9 3.28e-07 53 26 4 149 3 clpP ATP-dependent Clp protease proteolytic subunit Saccharum officinarum
Q6L377 3.28e-07 53 26 4 149 3 clpP ATP-dependent Clp protease proteolytic subunit Saccharum hybrid
Q824C7 3.29e-07 53 27 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B2A158 3.32e-07 53 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A1SUW7 3.43e-07 53 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7NEW2 3.48e-07 53 29 2 137 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q1ACH6 3.79e-07 53 28 4 153 3 clpP ATP-dependent Clp protease proteolytic subunit Chara vulgaris
Q3SI98 3.8e-07 53 28 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Thiobacillus denitrificans (strain ATCC 25259)
A9IR54 3.82e-07 53 26 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q9L4P3 3.93e-07 52 27 8 203 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5N1Q7 3.93e-07 52 27 8 203 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q5GS83 3.96e-07 53 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q3BAL3 4.13e-07 52 28 3 132 3 clpP ATP-dependent Clp protease proteolytic subunit Phalaenopsis aphrodite subsp. formosana
Q12LA1 4.24e-07 52 28 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
O83520 4.24e-07 52 25 1 134 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Treponema pallidum (strain Nichols)
B1HVR0 4.78e-07 52 27 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Lysinibacillus sphaericus (strain C3-41)
Q0ZIZ4 5e-07 52 27 3 134 3 clpP ATP-dependent Clp protease proteolytic subunit Vitis vinifera
O51556 5.16e-07 52 26 2 139 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A4QJV6 5.39e-07 52 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Olimarabidopsis pumila
A4QKV6 5.39e-07 52 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Crucihimalaya wallichii
A4QKD0 5.39e-07 52 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Barbarea verna
Q0AWF0 5.4e-07 52 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q3ZX82 5.4e-07 52 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Dehalococcoides mccartyi (strain CBDB1)
A5FRE5 5.4e-07 52 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q5P161 5.4e-07 52 27 3 155 3 clpP ATP-dependent Clp protease proteolytic subunit Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2W3H9 5.59e-07 52 26 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q135W7 5.68e-07 52 26 4 190 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisB5)
C5CJT4 5.79e-07 52 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Variovorax paradoxus (strain S110)
Q253I5 5.99e-07 52 27 2 133 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia felis (strain Fe/C-56)
Q2SWQ6 6.07e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A4QLD1 6.11e-07 52 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Lepidium virginicum
A4QJM4 6.11e-07 52 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Aethionema grandiflorum
A4QJE0 6.11e-07 52 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Aethionema cordifolium
P24064 6.56e-07 52 26 4 149 3 clpP ATP-dependent Clp protease proteolytic subunit Triticum aestivum
P56772 6.59e-07 52 28 3 133 1 clpP1 Chloroplastic ATP-dependent Clp protease proteolytic subunit 1 Arabidopsis thaliana
Q1RJH2 6.63e-07 52 25 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia bellii (strain RML369-C)
Q88YH9 6.78e-07 52 26 2 135 3 clpP ATP-dependent Clp protease proteolytic subunit Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q03SM3 6.88e-07 52 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q2PMR0 6.91e-07 52 29 4 134 3 clpP ATP-dependent Clp protease proteolytic subunit Glycine max
Q9SAA2 6.99e-07 53 25 4 155 1 CLPP6 ATP-dependent Clp protease proteolytic subunit 6, chloroplastic Arabidopsis thaliana
Q73I59 7.08e-07 52 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia pipientis wMel
B1Z9C7 7.08e-07 52 27 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q8ENM5 7.33e-07 52 24 5 194 3 clpP ATP-dependent Clp protease proteolytic subunit Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q2MI76 7.33e-07 52 26 4 145 3 clpP ATP-dependent Clp protease proteolytic subunit Solanum lycopersicum
B1MXG9 7.39e-07 52 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Leuconostoc citreum (strain KM20)
P12210 7.75e-07 52 27 3 133 2 clpP ATP-dependent Clp protease proteolytic subunit Nicotiana tabacum
Q33C07 7.75e-07 52 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Nicotiana tomentosiformis
Q3C1K4 7.75e-07 52 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Nicotiana sylvestris
Q3JRC9 7.93e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 1710b)
Q62JK7 7.93e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain ATCC 23344)
Q837R0 8.08e-07 52 29 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q27S24 8.25e-07 52 26 3 134 3 clpP ATP-dependent Clp protease proteolytic subunit Solanum tuberosum
Q2MIG3 8.25e-07 52 26 3 134 3 clpP ATP-dependent Clp protease proteolytic subunit Solanum bulbocastanum
Q82Y57 8.38e-07 52 27 2 144 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8RC25 8.43e-07 52 29 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q7V1W0 8.61e-07 52 24 2 158 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7VXI7 8.8e-07 52 26 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8X2 8.8e-07 52 26 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK83 8.8e-07 52 26 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q49KX3 9.38e-07 51 26 4 144 3 clpP ATP-dependent Clp protease proteolytic subunit Eucalyptus globulus subsp. globulus
Q2Y6J0 9.46e-07 52 27 3 156 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A4GYT6 9.47e-07 51 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Populus trichocarpa
Q14FD2 9.47e-07 51 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Populus alba
Q3Z8J8 9.56e-07 52 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q7V7R2 9.59e-07 51 25 3 154 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain MIT 9313)
Q63V41 9.85e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain K96243)
A3NAI5 9.85e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 668)
A3NWA6 9.85e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 1106a)
A1V4X1 9.85e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain SAVP1)
A2SBG3 9.85e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain NCTC 10229)
A3MKJ8 9.85e-07 52 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain NCTC 10247)
A2SFB5 1.01e-06 51 26 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1USA7 1.04e-06 52 25 2 148 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q1MIM7 1.04e-06 51 23 1 143 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A6Q1C1 1.05e-06 51 26 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Nitratiruptor sp. (strain SB155-2)
Q3ANI8 1.05e-06 52 26 1 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain CC9605)
Q74K84 1.06e-06 51 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q042E8 1.06e-06 51 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A8F754 1.08e-06 51 26 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A6MMN2 1.1e-06 51 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Dioscorea elephantipes
Q3SRD2 1.12e-06 51 26 5 204 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q2QD64 1.12e-06 51 25 3 135 3 clpP ATP-dependent Clp protease proteolytic subunit Cucumis sativus
P48883 1.17e-06 51 26 4 149 3 clpP ATP-dependent Clp protease proteolytic subunit Hordeum vulgare
A8EYM5 1.17e-06 51 25 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia canadensis (strain McKiel)
P0C314 1.18e-06 51 27 3 135 3 clpP ATP-dependent Clp protease proteolytic subunit Oryza sativa subsp. japonica
P0C313 1.18e-06 51 27 3 135 3 clpP ATP-dependent Clp protease proteolytic subunit Oryza sativa subsp. indica
P0C312 1.18e-06 51 27 3 135 3 clpP ATP-dependent Clp protease proteolytic subunit Oryza sativa
Q6ENE9 1.18e-06 51 27 3 135 3 clpP ATP-dependent Clp protease proteolytic subunit Oryza nivara
Q2L926 1.19e-06 51 28 4 133 3 clpP ATP-dependent Clp protease proteolytic subunit Gossypium hirsutum
Q9PJW1 1.2e-06 51 27 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia muridarum (strain MoPn / Nigg)
Q3B5V8 1.25e-06 52 24 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q9S834 1.26e-06 52 25 2 135 1 CLPP5 ATP-dependent Clp protease proteolytic subunit 5, chloroplastic Arabidopsis thaliana
Q06GN5 1.35e-06 51 26 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Piper cenocladum
A4QLV8 1.36e-06 51 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Nasturtium officinale
Q2K9U7 1.36e-06 51 23 1 143 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3YSQ3 1.37e-06 51 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia canis (strain Jake)
Q5FFG7 1.38e-06 51 26 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia ruminantium (strain Gardel)
Q0HTK7 1.44e-06 51 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sp. (strain MR-7)
P58277 1.51e-06 51 25 1 136 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium meliloti (strain 1021)
Q9F315 1.51e-06 51 28 2 149 2 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B0TLU9 1.58e-06 51 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella halifaxensis (strain HAW-EB4)
Q5N665 1.6e-06 51 26 3 153 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P54415 1.6e-06 51 26 3 153 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q0A6A7 1.65e-06 51 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q82CA6 1.66e-06 51 28 2 149 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q09G21 1.71e-06 51 27 5 147 3 clpP ATP-dependent Clp protease proteolytic subunit Platanus occidentalis
A8H614 1.72e-06 51 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
O67357 1.86e-06 50 28 2 136 1 clpP ATP-dependent Clp protease proteolytic subunit Aquifex aeolicus (strain VF5)
C1D539 1.98e-06 51 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Laribacter hongkongensis (strain HLHK9)
P74467 1.99e-06 50 25 8 209 3 clpP3 Probable ATP-dependent Clp protease proteolytic subunit 3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B8CRF7 2.02e-06 50 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella piezotolerans (strain WP3 / JCM 13877)
Q3ZJ12 2.02e-06 50 28 1 130 3 clpP ATP-dependent Clp protease proteolytic subunit Tupiella akineta
Q5HBX5 2.02e-06 50 26 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia ruminantium (strain Welgevonden)
A0A360 2.03e-06 50 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Coffea arabica
Q09FT6 2.03e-06 50 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Nandina domestica
B1L812 2.06e-06 50 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga sp. (strain RQ2)
A5IJ91 2.06e-06 50 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WZF9 2.06e-06 50 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q47XL8 2.12e-06 51 24 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4QK43 2.13e-06 50 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Arabis hirsuta
A5N2K8 2.14e-06 50 23 3 192 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E685 2.14e-06 50 23 3 192 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium kluyveri (strain NBRC 12016)
P38002 2.17e-06 50 26 3 136 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KLR9 2.17e-06 50 26 3 136 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
A0ZZ60 2.19e-06 50 28 4 133 3 clpP ATP-dependent Clp protease proteolytic subunit Gossypium barbadense
Q07ZX8 2.22e-06 50 27 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella frigidimarina (strain NCIMB 400)
Q3B0U1 2.23e-06 50 25 1 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain CC9902)
Q7YJV2 2.24e-06 50 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Calycanthus floridus var. glaucus
A9W5F5 2.32e-06 50 26 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum extorquens (strain PA1)
B7KNT0 2.32e-06 50 26 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A7Z939 2.58e-06 50 25 2 144 3 clpP ATP-dependent Clp protease proteolytic subunit Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2GFT8 2.79e-06 50 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q9K709 2.85e-06 50 24 3 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A6TM61 2.96e-06 50 25 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Alkaliphilus metalliredigens (strain QYMF)
B0B803 3.03e-06 50 26 3 136 1 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
A8FTH9 3.18e-06 50 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sediminis (strain HAW-EB3)
Q8G5Q9 3.25e-06 50 28 6 165 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bifidobacterium longum (strain NCC 2705)
Q06GX2 3.27e-06 50 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Drimys granadensis
Q660R2 3.28e-06 50 26 1 137 3 clpP ATP-dependent Clp protease proteolytic subunit Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
A1EA33 3.3e-06 50 25 3 135 3 clpP ATP-dependent Clp protease proteolytic subunit Agrostis stolonifera
Q7V992 3.45e-06 50 26 1 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain MIT 9313)
A9KWH7 3.52e-06 50 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella baltica (strain OS195)
A6WLQ1 3.52e-06 50 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella baltica (strain OS185)
A3D305 3.52e-06 50 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E5E9 3.52e-06 50 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella baltica (strain OS223)
Q8YP43 3.53e-06 50 25 6 202 3 clpP3 Probable ATP-dependent Clp protease proteolytic subunit 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6ME32 3.54e-06 50 26 3 136 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Protochlamydia amoebophila (strain UWE25)
A6MME7 3.69e-06 50 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Chloranthus spicatus
Q5WDK0 3.72e-06 50 25 5 194 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Shouchella clausii (strain KSM-K16)
Q9RQI6 3.74e-06 50 27 2 137 1 clpP ATP-dependent Clp protease proteolytic subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WV9 3.74e-06 50 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Listeria monocytogenes serotype 4b (strain F2365)
P57547 3.79e-06 50 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q93AD7 3.86e-06 50 27 8 202 3 clpP ATP-dependent Clp protease proteolytic subunit Rippkaea orientalis (strain PCC 8801 / RF-1)
Q928C4 3.92e-06 50 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8EG19 3.95e-06 50 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5FUR3 3.98e-06 50 25 2 136 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Gluconobacter oxydans (strain 621H)
Q2S2L8 4.2e-06 50 24 2 138 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Salinibacter ruber (strain DSM 13855 / M31)
A1AVN6 4.36e-06 50 28 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Ruthia magnifica subsp. Calyptogena magnifica
A0KYL9 4.73e-06 49 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sp. (strain ANA-3)
A8YUD9 4.76e-06 49 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus helveticus (strain DPC 4571)
Q72XW9 4.84e-06 49 26 2 138 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
A1RL89 4.95e-06 49 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sp. (strain W3-18-1)
A4Y5I2 4.95e-06 49 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1BI15 4.96e-06 50 23 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A8FHN9 4.97e-06 49 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Bacillus pumilus (strain SAFR-032)
Q6EW27 5e-06 49 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Nymphaea alba
A1XFY0 5e-06 49 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Nuphar advena
A0LEF1 5.1e-06 49 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q7UA36 5.11e-06 50 26 1 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Parasynechococcus marenigrum (strain WH8102)
Q0HHA1 5.24e-06 49 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sp. (strain MR-4)
A1W5B6 5.24e-06 49 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Acidovorax sp. (strain JS42)
Q9X6W8 5.33e-06 49 25 4 187 3 clpP ATP-dependent Clp protease proteolytic subunit Azospirillum brasilense
Q891J7 5.43e-06 49 24 3 192 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium tetani (strain Massachusetts / E88)
Q4ULF0 5.54e-06 49 25 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q7V9L6 5.85e-06 49 24 1 131 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A4QL44 5.88e-06 49 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Draba nemorosa
Q2RZ59 6.04e-06 50 26 2 135 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Salinibacter ruber (strain DSM 13855 / M31)
Q3AJN8 6.12e-06 49 27 5 155 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain CC9605)
Q3IF46 6.18e-06 49 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudoalteromonas translucida (strain TAC 125)
A8GNZ4 6.45e-06 49 25 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia akari (strain Hartford)
A5CXJ8 6.55e-06 49 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q8RHJ8 6.81e-06 49 27 3 137 3 clpP ATP-dependent Clp protease proteolytic subunit Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A1XGR3 6.83e-06 49 26 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Ranunculus macranthus
Q2JIP1 6.95e-06 49 25 2 136 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q9BBQ9 6.98e-06 49 27 4 133 3 clpP ATP-dependent Clp protease proteolytic subunit Lotus japonicus
A4GGD0 7.16e-06 49 27 3 132 3 clpP ATP-dependent Clp protease proteolytic subunit Phaseolus vulgaris
Q7UK66 7.23e-06 49 25 3 158 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P36387 7.25e-06 49 25 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Pinus contorta
Q7U6N7 7.32e-06 49 25 3 154 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Parasynechococcus marenigrum (strain WH8102)
Q8XYP7 7.61e-06 49 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q49VZ2 7.64e-06 49 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q73JM9 7.71e-06 49 26 2 126 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
B1KLT7 7.88e-06 49 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella woodyi (strain ATCC 51908 / MS32)
Q0SGZ1 7.89e-06 49 26 4 204 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhodococcus jostii (strain RHA1)
Q83G48 8.2e-06 48 29 5 135 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Tropheryma whipplei (strain Twist)
Q83I19 8.2e-06 48 29 5 135 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Tropheryma whipplei (strain TW08/27)
Q9X5N0 8.44e-06 49 26 2 134 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Myxococcus xanthus
A0LDT4 8.49e-06 48 23 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q31GF1 8.72e-06 48 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q1DAT0 8.76e-06 48 26 2 134 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Myxococcus xanthus (strain DK1622)
P26567 8.77e-06 49 26 4 149 3 clpP ATP-dependent Clp protease proteolytic subunit Zea mays
Q6HBD8 8.8e-06 48 25 2 138 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q631K2 8.8e-06 48 25 2 138 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ZK / E33L)
Q815J6 8.8e-06 48 25 2 138 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8UD57 8.98e-06 48 23 1 145 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0G9T7 9.11e-06 48 28 4 133 3 clpP ATP-dependent Clp protease proteolytic subunit Daucus carota
Q81X63 9.22e-06 48 25 2 138 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus anthracis
Q3MDK7 9.28e-06 48 25 5 199 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5PBD0 9.28e-06 49 27 3 136 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma marginale (strain St. Maries)
B9KHZ4 9.28e-06 49 27 3 136 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma marginale (strain Florida)
Q8UEX6 9.33e-06 48 26 3 155 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4JWV4 9.85e-06 48 26 2 138 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Corynebacterium jeikeium (strain K411)
Q8S8W2 1.01e-05 48 25 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Atropa belladonna
Q70XY2 1.04e-05 48 27 4 142 3 clpP ATP-dependent Clp protease proteolytic subunit Amborella trichopoda
A8EVH5 1.04e-05 48 24 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Aliarcobacter butzleri (strain RM4018)
A1TM62 1.05e-05 48 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Paracidovorax citrulli (strain AAC00-1)
Q5L8L6 1.06e-05 48 26 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A4SDA4 1.08e-05 48 24 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B1LW28 1.09e-05 48 25 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B9MG14 1.11e-05 48 27 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Acidovorax ebreus (strain TPSY)
Q3V509 1.12e-05 48 25 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Acorus calamus
Q3ATL3 1.13e-05 48 22 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium chlorochromatii (strain CaD3)
Q65EI5 1.13e-05 48 26 2 138 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8G5R0 1.2e-05 48 28 4 206 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bifidobacterium longum (strain NCC 2705)
A1S4X5 1.26e-05 48 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A1AN85 1.32e-05 48 26 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q38Y96 1.34e-05 48 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Latilactobacillus sakei subsp. sakei (strain 23K)
Q2JV68 1.36e-05 48 25 2 135 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain JA-3-3Ab)
B1Y6H3 1.37e-05 48 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A3QFX6 1.38e-05 48 27 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q5FL55 1.39e-05 48 26 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q73XM9 1.42e-05 48 27 4 202 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q5QA83 1.54e-05 48 25 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Acorus gramineus
Q0SGZ0 1.56e-05 48 27 2 137 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhodococcus jostii (strain RHA1)
Q64NW2 1.62e-05 48 26 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Bacteroides fragilis (strain YCH46)
Q0G9J4 1.64e-05 48 26 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Liriodendron tulipifera
A0Q2L1 1.65e-05 48 23 3 192 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium novyi (strain NT)
P80244 1.65e-05 48 25 2 137 1 clpP ATP-dependent Clp protease proteolytic subunit Bacillus subtilis (strain 168)
B6EHK3 1.66e-05 48 24 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Aliivibrio salmonicida (strain LFI1238)
Q09MF2 1.68e-05 48 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Citrus sinensis
Q87R80 1.69e-05 48 24 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q68RY2 1.75e-05 48 27 4 133 3 clpP ATP-dependent Clp protease proteolytic subunit Panax ginseng
Q1GB31 1.9e-05 48 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q83I18 1.9e-05 48 25 3 158 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Tropheryma whipplei (strain TW08/27)
Q83G49 1.9e-05 48 25 3 158 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Tropheryma whipplei (strain Twist)
Q7VAR9 1.96e-05 48 25 6 201 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q1MQ79 2.03e-05 48 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Lawsonia intracellularis (strain PHE/MN1-00)
Q4L4J5 2.05e-05 47 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus haemolyticus (strain JCSC1435)
P63786 2.09e-05 47 24 3 195 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MW2)
A8Z045 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain USA300 / TCH1516)
Q6GB62 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MSSA476)
Q6GIM3 2.09e-05 47 24 3 195 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MRSA252)
P99089 2.09e-05 47 24 3 195 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain N315)
P63785 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF76 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Newman)
Q5HHQ0 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain COL)
Q2YSF8 2.09e-05 47 24 3 195 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQX2 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain JH9)
Q2G036 2.09e-05 47 24 3 195 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIM5 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain USA300)
A6TZP7 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain JH1)
A7WZR9 2.09e-05 47 24 3 195 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8A129 2.09e-05 48 26 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q0P3P4 2.12e-05 47 27 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Ostreococcus tauri
B5FBZ8 2.21e-05 47 24 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Aliivibrio fischeri (strain MJ11)
Q5E6Q5 2.21e-05 47 24 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Aliivibrio fischeri (strain ATCC 700601 / ES114)
C4K1D4 2.24e-05 47 24 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia peacockii (strain Rustic)
Q317Y6 2.26e-05 48 23 1 134 3 clpP4 ATP-dependent Clp protease proteolytic subunit 4 Prochlorococcus marinus (strain MIT 9312)
Q8CTE0 2.34e-05 47 24 3 191 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQW0 2.34e-05 47 24 3 191 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1WUM7 2.35e-05 47 29 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Halorhodospira halophila (strain DSM 244 / SL1)
Q47MU2 2.44e-05 47 26 3 156 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Thermobifida fusca (strain YX)
Q92HM5 2.49e-05 47 24 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8MIS8 2.5e-05 47 25 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Alkaliphilus oremlandii (strain OhILAs)
Q04BH7 2.52e-05 47 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q13Z15 2.55e-05 47 26 2 134 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Paraburkholderia xenovorans (strain LB400)
B8IN26 2.64e-05 47 24 2 200 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q1KXT4 2.67e-05 47 26 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Helianthus annuus
A7MV87 2.84e-05 47 23 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio campbellii (strain ATCC BAA-1116)
Q9ZD29 2.86e-05 47 25 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia prowazekii (strain Madrid E)
A6MM61 3.18e-05 47 26 5 147 3 clpP ATP-dependent Clp protease proteolytic subunit Buxus microphylla
Q2JDQ9 3.23e-05 47 28 2 135 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q7V8M4 3.27e-05 47 25 6 201 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Prochlorococcus marinus (strain MIT 9313)
Q30Z79 3.3e-05 47 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
C0QGT0 3.33e-05 47 25 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q332V2 3.35e-05 47 26 3 133 3 clpP ATP-dependent Clp protease proteolytic subunit Lactuca sativa
Q8M9Y9 3.36e-05 47 25 5 161 3 clpP ATP-dependent Clp protease proteolytic subunit Chaetosphaeridium globosum
A6MMW9 3.36e-05 47 28 4 133 3 clpP ATP-dependent Clp protease proteolytic subunit Illicium oligandrum
B9DJL4 3.38e-05 47 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus carnosus (strain TM300)
A3DJ10 3.51e-05 47 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q2GJB4 3.52e-05 47 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma phagocytophilum (strain HZ)
Q8NN01 3.59e-05 47 26 2 136 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A7HFV9 3.59e-05 47 26 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Anaeromyxobacter sp. (strain Fw109-5)
B8FA62 3.66e-05 47 25 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfatibacillum aliphaticivorans
Q5Z062 3.73e-05 47 27 6 208 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Nocardia farcinica (strain IFM 10152)
Q3AY04 3.9e-05 47 25 3 154 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain CC9902)
Q1LTJ9 3.95e-05 47 23 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Baumannia cicadellinicola subsp. Homalodisca coagulata
Q9TL09 4.1e-05 47 26 1 130 3 clpP ATP-dependent Clp protease proteolytic subunit Nephroselmis olivacea
Q2NV79 4.31e-05 47 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Sodalis glossinidius (strain morsitans)
Q6FEP8 4.46e-05 47 25 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q46ID4 4.48e-05 47 22 1 135 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain NATL2A)
Q7MX09 4.61e-05 47 25 2 135 3 clpP ATP-dependent Clp protease proteolytic subunit Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q21KA9 4.62e-05 47 24 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7M7M3 4.75e-05 47 23 3 156 3 clpP ATP-dependent Clp protease proteolytic subunit Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9CBY4 4.83e-05 47 27 5 211 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mycobacterium leprae (strain TN)
B7VI00 5.04e-05 47 24 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio atlanticus (strain LGP32)
A7HZE8 5.12e-05 46 24 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q32RQ7 5.57e-05 46 27 6 168 3 clpP ATP-dependent Clp protease proteolytic subunit Zygnema circumcarinatum
Q03AL0 5.68e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WCR2 5.68e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Lacticaseibacillus casei (strain BL23)
B9DTU8 6.07e-05 46 24 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q1H1G0 6.34e-05 46 25 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A6Q675 6.42e-05 46 23 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Sulfurovum sp. (strain NBC37-1)
Q05FR8 6.59e-05 46 25 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Carsonella ruddii (strain PV)
Q73XM8 6.93e-05 46 26 3 146 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q7MMG7 6.93e-05 46 24 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio vulnificus (strain YJ016)
Q8DG26 6.93e-05 46 24 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio vulnificus (strain CMCP6)
C4Z1T6 7.04e-05 46 25 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q3Z4W6 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella sonnei (strain Ss046)
P0A6H0 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella flexneri
Q0T7E6 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella flexneri serotype 5b (strain 8401)
Q32JJ3 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella dysenteriae serotype 1 (strain Sd197)
Q325G4 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella boydii serotype 4 (strain Sb227)
Q1RF98 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli (strain UTI89 / UPEC)
P0A6G7 7.19e-05 46 25 2 138 1 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli (strain K12)
B1J011 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6G8 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKK4 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8A6 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O1:K1 / APEC
A7ZX95 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O9:H4 (strain HS)
P0A6G9 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O157:H7
A7ZIJ5 7.19e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
Q5KVD9 7.39e-05 46 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacillus kaustophilus (strain HTA426)
A4SM42 7.47e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Aeromonas salmonicida (strain A449)
Q06FP3 7.52e-05 46 29 3 133 3 clpP-A ATP-dependent Clp protease proteolytic subunit Pelargonium hortorum
P0A1D7 7.54e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1D8 7.54e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella typhi
B4TMC6 7.54e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella schwarzengrund (strain CVM19633)
B4SWU1 7.54e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella newport (strain SL254)
B4T9E3 7.54e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella heidelberg (strain SL476)
B5QTJ6 7.54e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella enteritidis PT4 (strain P125109)
Q57SB5 7.54e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella choleraesuis (strain SC-B67)
A5GFA0 7.98e-05 46 24 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Geotalea uraniireducens (strain Rf4)
B5BD83 8.28e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella paratyphi A (strain AKU_12601)
Q5PFN4 8.28e-05 46 25 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8GSH5 8.37e-05 46 24 2 158 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia rickettsii (strain Sheila Smith)
A4XHW0 8.67e-05 46 27 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q9Z832 9.15e-05 45 26 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia pneumoniae
Q6NFU4 0.000102 45 25 2 136 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q7UZK7 0.000103 46 23 1 136 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q9SXJ6 0.000124 46 22 2 137 1 CLPP3 ATP-dependent Clp protease proteolytic subunit 3, chloroplastic Arabidopsis thaliana
C3LNM6 0.000124 45 23 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain M66-2)
Q9KQS6 0.000124 45 23 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6X0 0.000124 45 23 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q0AJI2 0.000124 45 24 2 144 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1AVS9 0.000133 45 26 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
C5BCJ6 0.000137 45 25 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Edwardsiella ictaluri (strain 93-146)
B1L1D7 0.000145 45 23 3 191 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Loch Maree / Type A3)
B9EAG5 0.000147 45 26 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Macrococcus caseolyticus (strain JCSC5402)
Q6D827 0.000148 45 24 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B0TZA5 0.000166 45 24 2 139 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q6MH11 0.000166 45 26 4 165 3 clpP ATP-dependent Clp protease proteolytic subunit Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q5NNY8 0.000183 45 26 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P9WPC3 0.000184 45 27 5 211 1 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPC2 0.000184 45 27 5 211 2 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63784 0.000184 45 27 5 211 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q319H4 0.000191 45 25 7 204 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Prochlorococcus marinus (strain MIT 9312)
Q47FB6 0.000192 45 25 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Dechloromonas aromatica (strain RCB)
B9M0Y1 0.000204 45 24 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q74C82 0.000206 45 24 1 134 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8K990 0.000214 45 26 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q68WL5 0.000216 45 25 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q89WR7 0.000222 45 24 2 135 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O30612 0.000237 44 25 2 134 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Myxococcus xanthus (strain DK1622)
Q8DST7 0.000237 44 28 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q06J25 0.000246 44 22 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Bigelowiella natans
B8I8F5 0.000251 44 24 5 194 3 clpP ATP-dependent Clp protease proteolytic subunit Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A5D447 0.000263 44 26 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B0KJG6 0.000277 44 25 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas putida (strain GB-1)
Q0VQ90 0.000288 44 24 1 135 3 clpP ATP-dependent Clp protease proteolytic subunit Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4FM94 0.000288 44 25 6 191 3 clpP ATP-dependent Clp protease proteolytic subunit Pelagibacter ubique (strain HTCC1062)
Q9ZL50 0.000291 44 24 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain J99 / ATCC 700824)
Q85X43 0.000291 44 24 3 134 3 clpP ATP-dependent Clp protease proteolytic subunit Pinus koraiensis
B2FQR2 0.000295 44 24 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Stenotrophomonas maltophilia (strain K279a)
Q8FN36 0.000305 44 25 2 135 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9FN42 0.000322 44 24 5 211 1 CLPP2 ATP-dependent Clp protease proteolytic subunit 2, mitochondrial Arabidopsis thaliana
C4ZGF4 0.000332 44 25 2 137 3 clpP ATP-dependent Clp protease proteolytic subunit Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q1CT76 0.000342 44 24 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain HPAG1)
B5Z7F6 0.000342 44 24 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain G27)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_19255
Feature type CDS
Gene -
Product ATP-dependent Clp protease proteolytic subunit
Location 948 - 1799 (strand: 1)
Length 852 (nucleotides) / 283 (amino acids)

Contig

Accession ZDB_243
Length 13402 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3582
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00574 Clp protease

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0740 Posttranslational modification, protein turnover, chaperones (O) O ATP-dependent protease ClpP, protease subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01358 ATP-dependent Clp protease, protease subunit [EC:3.4.21.92] Cell cycle - Caulobacter
Longevity regulating pathway - worm
-

Protein Sequence

MKKSNLPAAPEGRPCASVNYELKPKALENWNSGIKAASADNTISILDVIGADMWGDGVSAKRIAAALRVIGDNDVVVNINSPGGDMFEGLAIYNLLRAHNGHVTVNVLGIAASAASIIAMAGDEILMGRGAFLMIHNCWAISMGNRHDFAKLAADLKPFDKAMAGIYMARTGQDEKDICRMMDEETYIGSSDAIDNGFADGLLAADAIDNGDETPQAAVRKIDALLAKTNTPRSERRKLISALTGSMPGAASDPEGTPCAAAEINPQTLSELEEAVRAFTPAR

Flanking regions ( +/- flanking 50bp)

GGTCCGCAACAACAATCCACGCAATCACCTCATTCCGGGGAGTAAATTTCATGAAAAAAAGTAACCTGCCGGCAGCGCCGGAGGGTCGCCCCTGCGCGTCAGTTAATTATGAACTGAAACCGAAAGCGCTGGAAAACTGGAACAGCGGCATAAAAGCAGCCAGTGCTGATAACACTATTTCCATTCTTGATGTGATCGGTGCCGATATGTGGGGTGATGGTGTTTCCGCAAAGCGGATTGCCGCAGCGCTGCGGGTTATCGGTGACAATGATGTGGTGGTGAATATTAACAGCCCCGGTGGTGACATGTTCGAAGGTCTGGCTATTTACAACCTGCTCAGGGCACACAATGGTCATGTCACCGTCAATGTCCTGGGTATCGCCGCGTCAGCAGCATCAATAATCGCGATGGCCGGAGATGAAATTCTGATGGGCCGGGGCGCGTTTCTGATGATCCATAACTGCTGGGCTATCAGCATGGGTAACCGACATGATTTTGCAAAACTGGCCGCTGATCTTAAGCCGTTTGATAAAGCCATGGCGGGTATCTATATGGCCAGAACCGGACAGGATGAAAAAGATATCTGCCGGATGATGGATGAAGAAACCTATATCGGCAGCAGCGATGCCATTGACAACGGGTTTGCCGATGGTCTTCTGGCAGCTGACGCTATCGATAACGGTGACGAAACCCCGCAGGCCGCGGTCAGAAAAATTGATGCGCTGCTGGCAAAAACAAACACACCGCGCTCTGAGCGCCGGAAACTGATTTCTGCTTTAACGGGAAGTATGCCGGGCGCTGCTTCCGATCCTGAAGGTACGCCATGCGCTGCCGCTGAAATAAATCCACAAACCCTATCTGAACTGGAAGAGGCGGTAAGAGCCTTTACTCCGGCACGTTAATTACTGGAGACATTATGTCTGATACAAACGAATTACTGAAAAGCCTGAAA