Homologs in group_2257

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17385 FBDBKF_17385 100.0 Morganella morganii S1 nrdR transcriptional regulator NrdR
NLDBIP_17915 NLDBIP_17915 100.0 Morganella morganii S4 nrdR transcriptional regulator NrdR
LHKJJB_17835 LHKJJB_17835 100.0 Morganella morganii S3 nrdR transcriptional regulator NrdR
HKOGLL_17845 HKOGLL_17845 100.0 Morganella morganii S5 nrdR transcriptional regulator NrdR
F4V73_RS16560 F4V73_RS16560 96.0 Morganella psychrotolerans nrdR transcriptional regulator NrdR
PMI_RS00385 PMI_RS00385 85.2 Proteus mirabilis HI4320 nrdR transcriptional regulator NrdR

Distribution of the homologs in the orthogroup group_2257

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2257

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N0I7 4.04e-96 276 89 0 148 3 nrdR Transcriptional repressor NrdR Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JNS5 1.27e-93 270 87 0 149 3 nrdR Transcriptional repressor NrdR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GAN5 4.48e-93 268 86 0 149 3 nrdR Transcriptional repressor NrdR Serratia proteamaculans (strain 568)
B1JIE4 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DW0 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPG9 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pestis (strain Pestoides F)
Q1CL94 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2J6 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC39 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pestis
B2K6T1 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C4I2 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLF0 1.18e-92 268 85 0 149 3 nrdR Transcriptional repressor NrdR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B4EU17 2.15e-92 267 85 0 149 3 nrdR Transcriptional repressor NrdR Proteus mirabilis (strain HI4320)
C6DB31 1.19e-91 265 85 0 149 3 nrdR Transcriptional repressor NrdR Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C5BCH3 3.38e-91 264 85 0 149 3 nrdR Transcriptional repressor NrdR Edwardsiella ictaluri (strain 93-146)
Q6D850 9.36e-91 263 83 0 149 3 nrdR Transcriptional repressor NrdR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MLX1 1.15e-90 263 84 0 149 3 nrdR Transcriptional repressor NrdR Cronobacter sakazakii (strain ATCC BAA-894)
A4W785 2.18e-90 262 83 0 149 3 nrdR Transcriptional repressor NrdR Enterobacter sp. (strain 638)
B2VHT2 9.69e-90 260 83 0 149 3 nrdR Transcriptional repressor NrdR Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B7LMH4 1.35e-89 260 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3Z4Z6 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Shigella sonnei (strain Ss046)
Q32JG7 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Shigella dysenteriae serotype 1 (strain Sd197)
Q325I8 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Shigella boydii serotype 4 (strain Sb227)
Q1RFC8 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli (strain UTI89 / UPEC)
B1LJG3 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli (strain SMS-3-5 / SECEC)
B6HZL4 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli (strain SE11)
B7N8W5 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8D0 2.78e-89 259 83 0 149 1 nrdR Transcriptional repressor NrdR Escherichia coli (strain K12)
B1J036 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8D1 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKM8 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A883 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O1:K1 / APEC
A7ZX65 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O9:H4 (strain HS)
B1XF01 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli (strain K12 / DH10B)
C4ZTH0 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli (strain K12 / MC4100 / BW2952)
B7M3Q2 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O8 (strain IAI1)
B7MQC8 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O81 (strain ED1a)
B7NJ84 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3R7 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8D2 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O157:H7
B7L647 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli (strain 55989 / EAEC)
B7MD71 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJN6 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIG6 2.78e-89 259 83 0 149 3 nrdR Transcriptional repressor NrdR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q2NVA0 4.12e-89 258 82 0 149 3 nrdR Transcriptional repressor NrdR Sodalis glossinidius (strain morsitans)
B2U4L6 5.3e-89 258 83 0 149 3 nrdR Transcriptional repressor NrdR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P0A2M1 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2M2 1.09e-88 258 81 0 149 5 nrdR Putative transcriptional repressor NrdR Salmonella typhi
B4TM95 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella schwarzengrund (strain CVM19633)
B5BDB7 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella paratyphi A (strain AKU_12601)
A9MX16 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PFS6 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SWQ7 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella newport (strain SL254)
B4T8Q6 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella heidelberg (strain SL476)
B5R6R6 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTG3 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella enteritidis PT4 (strain P125109)
B5FKS0 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella dublin (strain CT_02021853)
Q57SE9 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella choleraesuis (strain SC-B67)
B5EXF6 1.09e-88 258 81 0 149 3 nrdR Transcriptional repressor NrdR Salmonella agona (strain SL483)
O51824 3.35e-88 256 82 0 149 3 nrdR Transcriptional repressor NrdR Shigella flexneri
Q0T7H6 3.35e-88 256 82 0 149 3 nrdR Transcriptional repressor NrdR Shigella flexneri serotype 5b (strain 8401)
A6T5E6 5.8e-88 256 81 0 149 3 nrdR Transcriptional repressor NrdR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y0X8 5.8e-88 256 81 0 149 3 nrdR Transcriptional repressor NrdR Klebsiella pneumoniae (strain 342)
A0KNH2 1.51e-83 244 78 0 148 3 nrdR Transcriptional repressor NrdR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9KPU0 3.01e-83 244 77 0 149 3 nrdR Transcriptional repressor NrdR Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F601 3.01e-83 244 77 0 149 3 nrdR Transcriptional repressor NrdR Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A4SJN7 5.16e-83 243 79 0 148 3 nrdR Transcriptional repressor NrdR Aeromonas salmonicida (strain A449)
C4LAE5 2.47e-82 241 77 0 148 3 nrdR Transcriptional repressor NrdR Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q87RU8 2.88e-82 241 77 0 149 3 nrdR Transcriptional repressor NrdR Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C4K846 1.03e-81 240 75 0 149 3 nrdR Transcriptional repressor NrdR Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q7MN57 1.9e-81 239 75 0 149 3 nrdR Transcriptional repressor NrdR Vibrio vulnificus (strain YJ016)
Q8DF95 2.39e-81 239 75 0 149 3 nrdR Transcriptional repressor NrdR Vibrio vulnificus (strain CMCP6)
B7VJA9 5.76e-81 238 75 0 149 3 nrdR Transcriptional repressor NrdR Vibrio atlanticus (strain LGP32)
A3QC58 2.65e-80 236 75 0 149 3 nrdR Transcriptional repressor NrdR Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q6LU16 4.78e-80 236 75 0 148 3 nrdR Transcriptional repressor NrdR Photobacterium profundum (strain SS9)
B5FBF4 1.16e-79 234 75 0 148 3 nrdR Transcriptional repressor NrdR Aliivibrio fischeri (strain MJ11)
Q5E702 1.16e-79 234 75 0 148 3 nrdR Transcriptional repressor NrdR Aliivibrio fischeri (strain ATCC 700601 / ES114)
A8H1Q1 1.82e-79 234 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q3II24 2.22e-79 234 76 0 147 3 nrdR Transcriptional repressor NrdR Pseudoalteromonas translucida (strain TAC 125)
B8CJM8 2.64e-79 234 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella piezotolerans (strain WP3 / JCM 13877)
Q65SS8 6.5e-79 233 72 0 149 3 nrdR Transcriptional repressor NrdR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A8FSR0 6.79e-79 233 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella sediminis (strain HAW-EB3)
A1RHD1 6.94e-79 233 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella sp. (strain W3-18-1)
A4Y965 6.94e-79 233 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q086C8 8.09e-79 233 73 0 148 3 nrdR Transcriptional repressor NrdR Shewanella frigidimarina (strain NCIMB 400)
B0TJY6 1.56e-78 232 74 0 148 3 nrdR Transcriptional repressor NrdR Shewanella halifaxensis (strain HAW-EB4)
A9KYJ5 1.72e-78 232 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella baltica (strain OS195)
A6WR51 1.72e-78 232 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella baltica (strain OS185)
A3D7C9 1.72e-78 232 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E6W2 1.72e-78 232 75 0 148 3 nrdR Transcriptional repressor NrdR Shewanella baltica (strain OS223)
B6EI95 1.97e-78 231 73 0 148 3 nrdR Transcriptional repressor NrdR Aliivibrio salmonicida (strain LFI1238)
A1S4B6 2.73e-78 231 74 0 148 3 nrdR Transcriptional repressor NrdR Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5QXT5 2.79e-78 231 72 0 149 3 nrdR Transcriptional repressor NrdR Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B1KJK0 3.8e-78 231 73 0 148 3 nrdR Transcriptional repressor NrdR Shewanella woodyi (strain ATCC 51908 / MS32)
Q0HXJ5 3.92e-78 231 73 0 148 3 nrdR Transcriptional repressor NrdR Shewanella sp. (strain MR-7)
Q0HL92 3.92e-78 231 73 0 148 3 nrdR Transcriptional repressor NrdR Shewanella sp. (strain MR-4)
A0KU61 3.92e-78 231 73 0 148 3 nrdR Transcriptional repressor NrdR Shewanella sp. (strain ANA-3)
Q8EBN9 3.92e-78 231 73 0 148 3 nrdR Transcriptional repressor NrdR Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B4RV94 1.17e-77 229 73 0 149 3 nrdR1 Transcriptional repressor NrdR Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q12Q47 1.16e-76 227 70 0 148 3 nrdR Transcriptional repressor NrdR Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q15WA2 1.35e-76 227 71 0 149 3 nrdR Transcriptional repressor NrdR Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q4K592 1.99e-76 227 74 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K647 2.83e-76 226 74 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas fluorescens (strain Pf0-1)
Q9HWX1 6.5e-76 225 72 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02SM4 6.5e-76 225 72 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V7Q1 6.5e-76 225 72 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas aeruginosa (strain LESB58)
Q889R0 1.03e-75 225 73 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZMX9 1.82e-75 224 73 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas syringae pv. syringae (strain B728a)
Q48DB7 2.24e-75 224 73 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B1J3F1 2.56e-75 224 72 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas putida (strain W619)
Q9CMR2 3.55e-75 223 69 0 149 3 nrdR Transcriptional repressor NrdR Pasteurella multocida (strain Pm70)
Q88QI0 5.22e-75 223 72 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KL66 5.22e-75 223 72 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas putida (strain GB-1)
A5VXV6 5.22e-75 223 72 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P44946 7.24e-75 223 69 0 149 3 nrdR Transcriptional repressor NrdR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLW5 7.24e-75 223 69 0 149 3 nrdR Transcriptional repressor NrdR Haemophilus influenzae (strain 86-028NP)
A4XZ39 1.28e-74 222 72 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas mendocina (strain ymp)
Q21F15 1.58e-74 222 70 0 148 3 nrdR Transcriptional repressor NrdR Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1SUU1 2.1e-74 221 69 0 148 3 nrdR Transcriptional repressor NrdR Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q1IFM4 2.56e-74 221 71 0 147 3 nrdR Transcriptional repressor NrdR Pseudomonas entomophila (strain L48)
C1DLH3 4.72e-74 221 72 0 147 3 nrdR Transcriptional repressor NrdR Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q488N5 5.17e-74 221 68 0 147 3 nrdR Transcriptional repressor NrdR Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A5UDC6 2.03e-73 219 68 0 149 3 nrdR Transcriptional repressor NrdR Haemophilus influenzae (strain PittEE)
A1TYW9 3.15e-73 219 71 0 147 3 nrdR Transcriptional repressor NrdR Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
C5BS89 1.03e-72 217 68 0 148 3 nrdR Transcriptional repressor NrdR Teredinibacter turnerae (strain ATCC 39867 / T7901)
B0UUR2 2.21e-72 216 69 0 149 3 nrdR Transcriptional repressor NrdR Histophilus somni (strain 2336)
Q0I495 2.21e-72 216 69 0 149 3 nrdR Transcriptional repressor NrdR Histophilus somni (strain 129Pt)
A6VP30 6.06e-72 215 68 0 148 3 nrdR Transcriptional repressor NrdR Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q2S9R5 2.91e-71 214 69 0 147 3 nrdR Transcriptional repressor NrdR Hahella chejuensis (strain KCTC 2396)
Q0VMH5 3.07e-71 214 68 0 148 3 nrdR Transcriptional repressor NrdR Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B8F3G6 2.15e-68 206 65 0 149 3 nrdR Transcriptional repressor NrdR Glaesserella parasuis serovar 5 (strain SH0165)
Q83BT4 5.89e-68 205 66 0 148 3 nrdR Transcriptional repressor NrdR Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N8T7 5.89e-68 205 66 0 148 3 nrdR Transcriptional repressor NrdR Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KBN5 5.89e-68 205 66 0 148 3 nrdR Transcriptional repressor NrdR Coxiella burnetii (strain Dugway 5J108-111)
B6IZ81 5.89e-68 205 66 0 148 3 nrdR Transcriptional repressor NrdR Coxiella burnetii (strain CbuG_Q212)
B6J8Q8 5.89e-68 205 66 0 148 3 nrdR Transcriptional repressor NrdR Coxiella burnetii (strain CbuK_Q154)
A6W2L8 7.56e-68 206 64 0 148 3 nrdR Transcriptional repressor NrdR Marinomonas sp. (strain MWYL1)
Q607U5 1.61e-66 202 66 0 148 3 nrdR Transcriptional repressor NrdR Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1QUC5 2.6e-66 201 66 0 147 3 nrdR Transcriptional repressor NrdR Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B3GXE6 8.59e-65 197 62 0 149 3 nrdR Transcriptional repressor NrdR Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N075 8.59e-65 197 62 0 149 3 nrdR Transcriptional repressor NrdR Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q31FS7 1.08e-64 197 61 0 147 3 nrdR Transcriptional repressor NrdR Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q0ABQ8 1.65e-63 194 62 0 148 3 nrdR Transcriptional repressor NrdR Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B0BNZ1 1.87e-63 194 61 0 149 3 nrdR Transcriptional repressor NrdR Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B8GRT8 3.76e-63 194 63 0 148 3 nrdR Transcriptional repressor NrdR Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q4FPR9 1.66e-62 191 59 0 148 3 nrdR Transcriptional repressor NrdR Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A5WI35 4.04e-62 191 59 0 147 3 nrdR Transcriptional repressor NrdR Psychrobacter sp. (strain PRwf-1)
Q7VLP8 4.52e-62 190 60 0 149 3 nrdR Transcriptional repressor NrdR Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1Q7V5 1.66e-61 189 58 0 148 3 nrdR Transcriptional repressor NrdR Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B0VDB2 4.4e-61 188 58 0 148 3 nrdR Transcriptional repressor NrdR Acinetobacter baumannii (strain AYE)
A3M1A1 4.4e-61 188 58 0 148 3 nrdR Transcriptional repressor NrdR Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VMH0 4.4e-61 188 58 0 148 3 nrdR Transcriptional repressor NrdR Acinetobacter baumannii (strain SDF)
B2I1T3 4.4e-61 188 58 0 148 3 nrdR Transcriptional repressor NrdR Acinetobacter baumannii (strain ACICU)
B7I302 4.4e-61 188 58 0 148 3 nrdR Transcriptional repressor NrdR Acinetobacter baumannii (strain AB0057)
B7H1Q6 4.4e-61 188 58 0 148 3 nrdR Transcriptional repressor NrdR Acinetobacter baumannii (strain AB307-0294)
Q3J9K9 7.99e-61 188 58 0 148 3 nrdR Transcriptional repressor NrdR Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q6FFE5 5.86e-60 185 56 0 148 3 nrdR Transcriptional repressor NrdR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1AWS1 7.16e-59 182 59 0 147 3 nrdR Transcriptional repressor NrdR Ruthia magnifica subsp. Calyptogena magnifica
A1WVG5 7.33e-58 180 58 0 148 3 nrdR Transcriptional repressor NrdR Halorhodospira halophila (strain DSM 244 / SL1)
Q5WYH3 9.32e-58 179 59 0 149 3 nrdR Transcriptional repressor NrdR Legionella pneumophila (strain Lens)
Q5ZXK5 1.35e-57 179 59 0 149 3 nrdR Transcriptional repressor NrdR Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X721 1.35e-57 179 59 0 149 3 nrdR Transcriptional repressor NrdR Legionella pneumophila (strain Paris)
B2FNK6 1.61e-56 177 56 0 148 3 nrdR Transcriptional repressor NrdR Stenotrophomonas maltophilia (strain K279a)
B4SJB3 1.61e-56 177 56 0 148 3 nrdR Transcriptional repressor NrdR Stenotrophomonas maltophilia (strain R551-3)
C1D4D0 1.02e-55 174 56 0 144 3 nrdR Transcriptional repressor NrdR Laribacter hongkongensis (strain HLHK9)
Q8PCN3 2.47e-55 174 57 0 148 3 nrdR Transcriptional repressor NrdR Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RVE0 2.47e-55 174 57 0 148 3 nrdR Transcriptional repressor NrdR Xanthomonas campestris pv. campestris (strain B100)
Q4UQT7 2.47e-55 174 57 0 148 3 nrdR Transcriptional repressor NrdR Xanthomonas campestris pv. campestris (strain 8004)
Q3BXI6 6.11e-55 173 56 0 148 3 nrdR Transcriptional repressor NrdR Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PPE2 6.11e-55 173 56 0 148 3 nrdR Transcriptional repressor NrdR Xanthomonas axonopodis pv. citri (strain 306)
Q5GW09 6.59e-55 173 56 0 148 3 nrdR Transcriptional repressor NrdR Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZ85 6.59e-55 173 56 0 148 3 nrdR Transcriptional repressor NrdR Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2KV16 7.25e-55 172 55 0 148 3 nrdR Transcriptional repressor NrdR Bordetella avium (strain 197N)
A9I295 2.47e-54 171 54 0 148 3 nrdR Transcriptional repressor NrdR Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q7VUW8 4.31e-54 170 54 0 148 3 nrdR Transcriptional repressor NrdR Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W401 4.31e-54 170 54 0 148 3 nrdR Transcriptional repressor NrdR Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFD3 4.31e-54 170 54 0 148 3 nrdR Transcriptional repressor NrdR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B5ELV4 1.46e-53 169 56 0 149 3 nrdR Transcriptional repressor NrdR Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J440 1.46e-53 169 56 0 149 3 nrdR Transcriptional repressor NrdR Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q1H004 2.49e-51 163 53 0 147 3 nrdR Transcriptional repressor NrdR Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4G7M3 5.46e-51 162 52 0 145 3 nrdR Transcriptional repressor NrdR Herminiimonas arsenicoxydans
Q7NYI7 6.55e-51 162 54 0 148 3 nrdR Transcriptional repressor NrdR Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q87AS3 1.36e-50 162 52 0 148 3 nrdR Transcriptional repressor NrdR Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I8Q9 1.36e-50 162 52 0 148 3 nrdR Transcriptional repressor NrdR Xylella fastidiosa (strain M23)
A6T0T5 1.4e-50 161 53 0 145 3 nrdR Transcriptional repressor NrdR Janthinobacterium sp. (strain Marseille)
B0U4K7 1.51e-50 162 52 0 148 3 nrdR Transcriptional repressor NrdR Xylella fastidiosa (strain M12)
Q1D346 2.88e-50 161 52 0 149 3 nrdR Transcriptional repressor NrdR Myxococcus xanthus (strain DK1622)
B0S0Z8 4.4e-50 160 51 0 149 3 nrdR Transcriptional repressor NrdR Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q3A4L7 4.7e-50 160 52 0 144 3 nrdR Transcriptional repressor NrdR Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A5G3K3 1.01e-49 159 53 0 147 3 nrdR Transcriptional repressor NrdR Geotalea uraniireducens (strain Rf4)
B9M1E2 1.37e-49 159 52 0 147 3 nrdR Transcriptional repressor NrdR Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B8I3X2 1.59e-49 159 50 0 147 3 nrdR Transcriptional repressor NrdR Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q9PET0 1.63e-49 159 52 0 148 3 nrdR Transcriptional repressor NrdR Xylella fastidiosa (strain 9a5c)
A4SVI7 1.69e-49 158 51 0 148 3 nrdR Transcriptional repressor NrdR Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A7HDY7 2.67e-49 158 50 0 147 3 nrdR Transcriptional repressor NrdR Anaeromyxobacter sp. (strain Fw109-5)
C6E3M1 4.14e-49 157 53 0 147 3 nrdR Transcriptional repressor NrdR Geobacter sp. (strain M21)
B5E858 4.14e-49 157 53 0 147 3 nrdR Transcriptional repressor NrdR Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A2SK03 8.46e-49 156 54 0 144 3 nrdR Transcriptional repressor NrdR Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q2YD57 8.65e-49 157 54 0 148 3 nrdR Transcriptional repressor NrdR Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B3R5S1 1.1e-48 156 52 0 145 3 nrdR Transcriptional repressor NrdR Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q47IH0 1.59e-48 156 53 0 144 3 nrdR Transcriptional repressor NrdR Dechloromonas aromatica (strain RCB)
Q474L4 1.84e-48 156 51 0 145 3 nrdR Transcriptional repressor NrdR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q145A5 2.05e-48 156 55 0 144 3 nrdR Transcriptional repressor NrdR Paraburkholderia xenovorans (strain LB400)
Q0AFT7 2.97e-48 155 50 0 148 3 nrdR Transcriptional repressor NrdR Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A6TS50 3.73e-48 155 48 0 147 3 nrdR Transcriptional repressor NrdR Alkaliphilus metalliredigens (strain QYMF)
Q0K7V9 6.87e-48 154 53 0 140 3 nrdR Transcriptional repressor NrdR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LJX2 7.66e-48 154 54 0 142 3 nrdR Transcriptional repressor NrdR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B9K7Y8 1.1e-47 154 52 0 148 3 nrdR Transcriptional repressor NrdR Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A5ILE8 1.16e-47 154 52 0 148 3 nrdR Transcriptional repressor NrdR Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q2LQM8 2.01e-47 153 47 0 148 3 nrdR Transcriptional repressor NrdR Syntrophus aciditrophicus (strain SB)
A3DCK9 2.74e-47 153 49 0 147 3 nrdR Transcriptional repressor NrdR Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B2JG93 2.98e-47 153 54 0 144 3 nrdR Transcriptional repressor NrdR Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
C5CPY1 3.26e-47 152 55 0 140 3 nrdR Transcriptional repressor NrdR Variovorax paradoxus (strain S110)
A9BFB9 4.03e-47 152 48 0 149 3 nrdR Transcriptional repressor NrdR Petrotoga mobilis (strain DSM 10674 / SJ95)
Q0BHY0 4.04e-47 152 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YTX4 4.04e-47 152 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia ambifaria (strain MC40-6)
B1JWI0 4.46e-47 152 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia orbicola (strain MC0-3)
A0K4Y3 4.46e-47 152 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia cenocepacia (strain HI2424)
A7HM70 4.67e-47 152 48 0 149 3 nrdR Transcriptional repressor NrdR Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A4JBU8 4.98e-47 152 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9AFP3 5.26e-47 152 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia multivorans (strain ATCC 17616 / 249)
B3EB70 5.35e-47 152 52 1 149 3 nrdR Transcriptional repressor NrdR Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B2U7G6 5.79e-47 152 52 0 140 3 nrdR Transcriptional repressor NrdR Ralstonia pickettii (strain 12J)
Q8Y1G2 6.89e-47 152 52 0 140 3 nrdR Transcriptional repressor NrdR Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B8JEW8 7.68e-47 152 48 0 147 3 nrdR Transcriptional repressor NrdR Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q9X233 8.37e-47 152 52 0 148 3 nrdR Transcriptional repressor NrdR Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A1APE2 8.56e-47 151 49 0 147 3 nrdR Transcriptional repressor NrdR Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q2ILI2 8.64e-47 152 48 0 147 3 nrdR Transcriptional repressor NrdR Anaeromyxobacter dehalogenans (strain 2CP-C)
B4UIM6 8.76e-47 152 48 0 147 3 nrdR Transcriptional repressor NrdR Anaeromyxobacter sp. (strain K)
A8MH47 9.37e-47 152 46 0 147 3 nrdR Transcriptional repressor NrdR Alkaliphilus oremlandii (strain OhILAs)
Q63RB5 9.79e-47 152 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia pseudomallei (strain K96243)
A3NCY6 9.79e-47 152 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia pseudomallei (strain 668)
Q3JP82 9.79e-47 152 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia pseudomallei (strain 1710b)
A3NYQ0 9.79e-47 152 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia pseudomallei (strain 1106a)
A1V1S2 9.79e-47 152 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia mallei (strain SAVP1)
Q62I17 9.79e-47 152 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia mallei (strain ATCC 23344)
A2S9K2 9.79e-47 152 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia mallei (strain NCTC 10229)
A3MMJ2 9.79e-47 152 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia mallei (strain NCTC 10247)
Q39J71 1e-46 152 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B4ECY8 1e-46 152 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A1TRH2 1.53e-46 151 55 0 140 3 nrdR Transcriptional repressor NrdR Paracidovorax citrulli (strain AAC00-1)
B1XYE8 1.64e-46 150 52 0 144 3 nrdR Transcriptional repressor NrdR Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q1BYR9 1.69e-46 151 55 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia orbicola (strain AU 1054)
B2T084 1.9e-46 151 54 0 144 3 nrdR Transcriptional repressor NrdR Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B9L287 1.94e-46 151 49 0 147 3 nrdR Transcriptional repressor NrdR Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q2SYS3 2.01e-46 151 54 0 144 3 nrdR Transcriptional repressor NrdR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q74CI6 2.58e-46 150 51 0 147 3 nrdR Transcriptional repressor NrdR Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A1W6H5 2.76e-46 150 53 0 140 3 nrdR Transcriptional repressor NrdR Acidovorax sp. (strain JS42)
B9MAC9 2.76e-46 150 53 0 140 3 nrdR Transcriptional repressor NrdR Acidovorax ebreus (strain TPSY)
Q6MNX8 3.9e-46 151 49 1 144 3 nrdR Transcriptional repressor NrdR Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q6AJG5 5.78e-46 150 49 0 149 3 nrdR Transcriptional repressor NrdR Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q21V28 1.01e-45 149 51 0 140 3 nrdR Transcriptional repressor NrdR Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q82UQ0 1.23e-45 149 50 0 148 3 nrdR Transcriptional repressor NrdR Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q895Y6 1.56e-45 148 47 0 149 3 nrdR Transcriptional repressor NrdR Clostridium tetani (strain Massachusetts / E88)
Q3SGX4 1.98e-45 148 56 0 140 3 nrdR Transcriptional repressor NrdR Thiobacillus denitrificans (strain ATCC 25259)
A1WQP5 8.24e-45 146 52 0 140 3 nrdR Transcriptional repressor NrdR Verminephrobacter eiseniae (strain EF01-2)
A9GWT4 1.18e-44 146 49 0 147 3 nrdR Transcriptional repressor NrdR Sorangium cellulosum (strain So ce56)
Q182X3 1.63e-44 146 48 1 147 3 nrdR Transcriptional repressor NrdR Clostridioides difficile (strain 630)
A9KNG9 1.64e-44 146 45 0 149 3 nrdR Transcriptional repressor NrdR Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
C4Z8V7 2.15e-44 145 45 0 149 3 nrdR Transcriptional repressor NrdR Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
A8F4K3 2.23e-44 145 49 0 140 3 nrdR Transcriptional repressor NrdR Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q129K2 2.77e-44 145 50 0 140 3 nrdR Transcriptional repressor NrdR Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1VRC9 3.16e-44 145 50 0 140 3 nrdR Transcriptional repressor NrdR Polaromonas naphthalenivorans (strain CJ2)
A1K9B3 3.37e-44 145 52 0 148 3 nrdR Transcriptional repressor NrdR Azoarcus sp. (strain BH72)
B0UML4 3.6e-44 146 51 0 148 3 nrdR Transcriptional repressor NrdR Methylobacterium sp. (strain 4-46)
B0K8L8 3.89e-44 145 46 0 147 3 nrdR Transcriptional repressor NrdR Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8Y6W9 3.97e-44 145 48 0 149 3 nrdR Transcriptional repressor NrdR Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DHI6 3.97e-44 145 48 0 149 3 nrdR Transcriptional repressor NrdR Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZA5 3.97e-44 145 48 0 149 3 nrdR Transcriptional repressor NrdR Listeria monocytogenes serotype 4b (strain F2365)
C1KVK9 3.97e-44 145 48 0 149 3 nrdR Transcriptional repressor NrdR Listeria monocytogenes serotype 4b (strain CLIP80459)
A9BMP0 4.13e-44 145 51 0 140 3 nrdR Transcriptional repressor NrdR Delftia acidovorans (strain DSM 14801 / SPH-1)
A0AJ11 4.33e-44 145 48 0 149 3 nrdR Transcriptional repressor NrdR Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B5XJV7 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M49 (strain NZ131)
P0DC75 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48V66 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RGB3 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J8D2 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JIH7 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JNC7 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDF4 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M12 (strain MGAS2096)
P67322 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DC74 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P67320 4.41e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M1
B0K3F9 4.73e-44 145 46 0 147 3 nrdR Transcriptional repressor NrdR Thermoanaerobacter sp. (strain X514)
Q5XDR6 4.92e-44 145 46 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A7GGB7 7.21e-44 144 45 0 149 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IIP2 7.21e-44 144 45 0 149 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain Okra / Type B1)
C1FSV2 7.21e-44 144 45 0 149 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain Kyoto / Type A2)
A5I4W1 7.21e-44 144 45 0 149 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FW99 7.21e-44 144 45 0 149 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain ATCC 19397 / Type A)
Q92BF3 7.24e-44 144 48 0 149 3 nrdR Transcriptional repressor NrdR Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B6IMS9 1.21e-43 144 50 0 148 3 nrdR Transcriptional repressor NrdR Rhodospirillum centenum (strain ATCC 51521 / SW)
B9MJV0 1.29e-43 144 44 0 147 3 nrdR Transcriptional repressor NrdR Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
C3L117 1.47e-43 143 45 0 149 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain 657 / Type Ba4)
B8G2S3 1.7e-43 144 48 0 147 3 nrdR Transcriptional repressor NrdR Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q0BTE7 2.36e-43 143 51 0 140 3 nrdR Transcriptional repressor NrdR Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q7UG92 2.55e-43 143 47 0 148 3 nrdR Transcriptional repressor NrdR Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A4XL57 2.57e-43 143 45 0 147 3 nrdR Transcriptional repressor NrdR Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B9DTQ0 2.91e-43 143 49 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q1GV13 2.92e-43 143 51 0 142 3 nrdR Transcriptional repressor NrdR Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q8R9H6 3.06e-43 143 46 0 147 3 nrdR Transcriptional repressor NrdR Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5NN84 3.07e-43 143 50 1 146 3 nrdR Transcriptional repressor NrdR Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B1YK95 3.7e-43 142 46 0 149 3 nrdR Transcriptional repressor NrdR Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
C5CA18 4.13e-43 142 48 1 148 3 nrdR Transcriptional repressor NrdR Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
A5D165 4.53e-43 142 48 0 147 3 nrdR Transcriptional repressor NrdR Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B2GDB8 5.6e-43 142 47 0 148 3 nrdR Transcriptional repressor NrdR Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
P33661 6.83e-43 142 47 0 147 3 nrdR Transcriptional repressor NrdR Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B8HGY5 7.38e-43 142 46 1 148 3 nrdR Transcriptional repressor NrdR Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
B1KX81 7.7e-43 142 44 0 149 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain Loch Maree / Type A3)
Q39V70 8.33e-43 141 48 1 149 3 nrdR Transcriptional repressor NrdR Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B6JGI0 9.01e-43 142 46 0 149 3 nrdR Transcriptional repressor NrdR Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
C0MGE9 9.99e-43 142 45 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus equi subsp. zooepidemicus (strain H70)
B4U4S8 9.99e-43 142 45 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M815 9.99e-43 142 45 0 149 3 nrdR Transcriptional repressor NrdR Streptococcus equi subsp. equi (strain 4047)
Q214H6 1.05e-42 141 47 1 155 3 nrdR Transcriptional repressor NrdR Rhodopseudomonas palustris (strain BisB18)
A8AVL4 1.17e-42 141 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q03MB4 1.44e-42 141 48 0 142 3 nrdR Transcriptional repressor NrdR Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q030M1 1.68e-42 140 50 1 142 3 nrdR Transcriptional repressor NrdR Lactococcus lactis subsp. cremoris (strain SK11)
A2RM54 1.68e-42 140 50 1 142 3 nrdR Transcriptional repressor NrdR Lactococcus lactis subsp. cremoris (strain MG1363)
Q9CHI1 1.68e-42 140 50 1 142 3 nrdR Transcriptional repressor NrdR Lactococcus lactis subsp. lactis (strain IL1403)
Q1AS42 1.76e-42 141 46 0 147 3 nrdR Transcriptional repressor NrdR Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A4J2C8 1.77e-42 141 51 0 147 3 nrdR Transcriptional repressor NrdR Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B8CWK6 1.82e-42 140 44 0 147 3 nrdR Transcriptional repressor NrdR Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q2W4T1 1.94e-42 140 47 0 147 3 nrdR3 Transcriptional repressor NrdR 3 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q5M5X8 2.95e-42 140 48 0 142 3 nrdR Transcriptional repressor NrdR Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1E2 2.95e-42 140 48 0 142 3 nrdR Transcriptional repressor NrdR Streptococcus thermophilus (strain CNRZ 1066)
B8ILE2 3.29e-42 141 50 0 147 3 nrdR Transcriptional repressor NrdR Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B1XTC4 4.08e-42 139 50 0 148 3 nrdR Transcriptional repressor NrdR Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q2W5J7 4.16e-42 140 47 0 147 3 nrdR2 Transcriptional repressor NrdR 2 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q45549 4.21e-42 140 51 0 147 3 nrdR Transcriptional repressor NrdR Bacillus subtilis (strain 168)
C5CHN3 4.88e-42 140 48 0 149 3 nrdR Transcriptional repressor NrdR Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
C4L464 5.26e-42 139 48 0 147 3 nrdR Transcriptional repressor NrdR Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A4VX57 5.67e-42 140 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus suis (strain 05ZYH33)
A4W3G1 5.67e-42 140 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus suis (strain 98HAH33)
Q0SS62 6.36e-42 139 46 0 147 3 nrdR Transcriptional repressor NrdR Clostridium perfringens (strain SM101 / Type A)
Q0APF9 6.87e-42 139 51 1 143 3 nrdR Transcriptional repressor NrdR Maricaulis maris (strain MCS10)
Q037Z3 8.13e-42 139 46 0 144 3 nrdR Transcriptional repressor NrdR Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WF53 8.13e-42 139 46 0 144 3 nrdR Transcriptional repressor NrdR Lacticaseibacillus casei (strain BL23)
Q1WUN5 8.54e-42 139 45 0 149 3 nrdR Transcriptional repressor NrdR Ligilactobacillus salivarius (strain UCC118)
A5N7V5 1.13e-41 139 44 0 147 3 nrdR Transcriptional repressor NrdR Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E1B6 1.13e-41 139 44 0 147 3 nrdR Transcriptional repressor NrdR Clostridium kluyveri (strain NBRC 12016)
A3CPT4 1.34e-41 139 45 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus sanguinis (strain SK36)
A5URZ5 1.46e-41 138 46 0 147 3 nrdR Transcriptional repressor NrdR Roseiflexus sp. (strain RS-1)
Q07MT8 1.92e-41 138 49 0 140 3 nrdR Transcriptional repressor NrdR Rhodopseudomonas palustris (strain BisA53)
C1CSX4 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae (strain Taiwan19F-14)
C1CM49 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae (strain P1031)
C1CFT4 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae (strain JJA)
P67319 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P67318 2.13e-41 138 47 0 140 1 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZMH8 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I770 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae (strain Hungary19A-6)
C1C8U9 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae (strain 70585)
B5E760 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae serotype 19F (strain G54)
Q04J60 2.13e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0Q128 2.53e-41 138 44 0 147 3 nrdR Transcriptional repressor NrdR Clostridium novyi (strain NT)
B2THP9 2.56e-41 137 45 0 147 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain Eklund 17B / Type B)
Q8XJJ7 2.57e-41 137 45 0 147 3 nrdR Transcriptional repressor NrdR Clostridium perfringens (strain 13 / Type A)
Q0TPJ5 2.57e-41 137 45 0 147 3 nrdR Transcriptional repressor NrdR Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q73N26 2.82e-41 137 45 1 150 3 nrdR Transcriptional repressor NrdR Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q9K861 2.96e-41 137 46 0 149 3 nrdR Transcriptional repressor NrdR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B2V3Y1 2.99e-41 137 44 0 147 3 nrdR Transcriptional repressor NrdR Clostridium botulinum (strain Alaska E43 / Type E3)
Q1QMB8 3.31e-41 138 47 0 140 3 nrdR Transcriptional repressor NrdR Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q3SRV4 3.57e-41 137 48 0 140 3 nrdR Transcriptional repressor NrdR Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A8I0I5 4.46e-41 138 46 0 148 3 nrdR Transcriptional repressor NrdR Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q136T8 4.54e-41 137 46 1 154 3 nrdR Transcriptional repressor NrdR Rhodopseudomonas palustris (strain BisB5)
Q2IWS3 4.95e-41 137 46 1 154 3 nrdR Transcriptional repressor NrdR Rhodopseudomonas palustris (strain HaA2)
B1LZ89 5.47e-41 138 48 0 149 3 nrdR Transcriptional repressor NrdR Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q5KWC8 5.52e-41 137 48 0 147 3 nrdR Transcriptional repressor NrdR Geobacillus kaustophilus (strain HTA426)
A0JVB0 5.68e-41 137 45 1 148 3 nrdR Transcriptional repressor NrdR Arthrobacter sp. (strain FB24)
C5D643 5.76e-41 137 48 0 147 3 nrdR Transcriptional repressor NrdR Geobacillus sp. (strain WCH70)
Q2NAS1 6.93e-41 137 46 0 149 3 nrdR Transcriptional repressor NrdR Erythrobacter litoralis (strain HTCC2594)
B1HWD3 7.26e-41 137 52 0 144 3 nrdR Transcriptional repressor NrdR Lysinibacillus sphaericus (strain C3-41)
A9B4R2 7.3e-41 136 46 1 149 3 nrdR Transcriptional repressor NrdR Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A7INA4 1.38e-40 137 46 0 147 3 nrdR Transcriptional repressor NrdR Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A7NP08 1.4e-40 136 45 0 147 3 nrdR Transcriptional repressor NrdR Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q3AAG3 1.47e-40 136 46 0 147 3 nrdR Transcriptional repressor NrdR Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q6HCV0 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q633L6 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cereus (strain ZK / E33L)
Q817H0 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HRL9 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cereus (strain AH187)
B7HF94 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cereus (strain B4264)
C1EUS4 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cereus (strain 03BB102)
B7IJX8 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cereus (strain G9842)
Q72ZF7 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JR87 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cereus (strain AH820)
Q81L10 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus anthracis
C3L8V8 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PAG9 1.75e-40 135 49 0 144 3 nrdR Transcriptional repressor NrdR Bacillus anthracis (strain A0248)
Q5P7P0 2.27e-40 136 52 0 144 3 nrdR Transcriptional repressor NrdR Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2RTB9 2.63e-40 135 48 0 140 3 nrdR Transcriptional repressor NrdR Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0AYE0 2.67e-40 135 45 0 148 3 nrdR Transcriptional repressor NrdR Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B8ERJ6 2.84e-40 136 46 0 147 3 nrdR Transcriptional repressor NrdR Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
C5BWL5 2.93e-40 135 47 1 148 3 nrdR Transcriptional repressor NrdR Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
Q2G644 3.17e-40 135 46 0 149 3 nrdR Transcriptional repressor NrdR Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A5G0D9 3.25e-40 135 49 0 140 3 nrdR Transcriptional repressor NrdR Acidiphilium cryptum (strain JF-5)
B3QJK5 3.34e-40 135 48 0 140 3 nrdR Transcriptional repressor NrdR Rhodopseudomonas palustris (strain TIE-1)
Q6N692 3.34e-40 135 48 0 140 3 nrdR Transcriptional repressor NrdR Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3Z9K8 3.58e-40 135 46 1 147 3 nrdR Transcriptional repressor NrdR Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q041U3 3.59e-40 135 45 0 144 3 nrdR Transcriptional repressor NrdR Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B7KFG7 4.98e-40 135 43 0 148 3 nrdR Transcriptional repressor NrdR Gloeothece citriformis (strain PCC 7424)
A8YWE4 5.07e-40 134 46 0 140 3 nrdR Transcriptional repressor NrdR Lactobacillus helveticus (strain DPC 4571)
C0QKX1 5.36e-40 135 46 0 147 3 nrdR Transcriptional repressor NrdR Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q65GA0 5.46e-40 134 48 0 147 3 nrdR Transcriptional repressor NrdR Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8DS88 6.29e-40 134 46 0 140 3 nrdR Transcriptional repressor NrdR Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A6LSH5 6.85e-40 134 43 0 148 3 nrdR Transcriptional repressor NrdR Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B8HVN1 7.83e-40 135 44 0 148 3 nrdR Transcriptional repressor NrdR Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B4RB34 7.93e-40 134 48 0 141 3 nrdR Transcriptional repressor NrdR Phenylobacterium zucineum (strain HLK1)
B2G8B2 8.77e-40 134 45 0 144 3 nrdR Transcriptional repressor NrdR Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VKX7 8.77e-40 134 45 0 144 3 nrdR Transcriptional repressor NrdR Limosilactobacillus reuteri (strain DSM 20016)
A9WS75 8.91e-40 134 45 1 144 3 nrdR Transcriptional repressor NrdR Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A0LUY9 1.01e-39 134 47 1 145 3 nrdR Transcriptional repressor NrdR Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A6W857 1.2e-39 134 45 1 148 3 nrdR Transcriptional repressor NrdR Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q67KQ1 1.29e-39 133 48 1 147 3 nrdR Transcriptional repressor NrdR Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q837G1 1.3e-39 134 43 0 149 3 nrdR Transcriptional repressor NrdR Enterococcus faecalis (strain ATCC 700802 / V583)
Q74IB7 1.39e-39 133 45 0 144 3 nrdR Transcriptional repressor NrdR Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
C0Z7Z5 1.49e-39 134 45 0 147 3 nrdR Transcriptional repressor NrdR Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q1IJA9 1.6e-39 134 46 1 149 3 nrdR Transcriptional repressor NrdR Koribacter versatilis (strain Ellin345)
Q38VS7 1.86e-39 133 44 0 147 3 nrdR Transcriptional repressor NrdR Latilactobacillus sakei subsp. sakei (strain 23K)
A1R5H3 1.89e-39 133 43 1 148 3 nrdR Transcriptional repressor NrdR Paenarthrobacter aurescens (strain TC1)
Q3ZZA1 2.02e-39 134 45 1 147 3 nrdR Transcriptional repressor NrdR Dehalococcoides mccartyi (strain CBDB1)
Q89K77 2.08e-39 133 46 1 155 3 nrdR Transcriptional repressor NrdR Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A9VJP3 2.1e-39 133 48 0 144 3 nrdR Transcriptional repressor NrdR Bacillus mycoides (strain KBAB4)
Q2W8V2 2.17e-39 133 44 0 147 3 nrdR1 Transcriptional repressor NrdR 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A7HX83 2.18e-39 133 45 0 147 3 nrdR Transcriptional repressor NrdR Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A5FSC0 2.28e-39 134 45 1 147 3 nrdR Transcriptional repressor NrdR Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A7GTM7 2.37e-39 133 47 0 144 3 nrdR Transcriptional repressor NrdR Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A1SNC7 2.38e-39 133 45 1 148 3 nrdR Transcriptional repressor NrdR Nocardioides sp. (strain ATCC BAA-499 / JS614)
B8E395 2.47e-39 132 42 0 149 3 nrdR Transcriptional repressor NrdR Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q02AX2 3.02e-39 132 44 0 147 3 nrdR Transcriptional repressor NrdR Solibacter usitatus (strain Ellin6076)
A5V5D2 3.17e-39 132 50 0 140 3 nrdR Transcriptional repressor NrdR Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
C1D0D5 3.85e-39 132 46 1 149 3 nrdR Transcriptional repressor NrdR Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q253H1 4.53e-39 132 46 1 142 3 nrdR Transcriptional repressor NrdR Chlamydia felis (strain Fe/C-56)
Q824E0 4.53e-39 132 46 1 142 3 nrdR Transcriptional repressor NrdR Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q5L6Q6 4.53e-39 132 46 1 142 3 nrdR Transcriptional repressor NrdR Chlamydia abortus (strain DSM 27085 / S26/3)
B8FJ73 4.62e-39 132 45 0 147 3 nrdR Transcriptional repressor NrdR Desulfatibacillum aliphaticivorans
Q3YSX9 4.82e-39 132 43 0 147 3 nrdR Transcriptional repressor NrdR Ehrlichia canis (strain Jake)
O86848 4.88e-39 132 43 1 149 3 nrdR Transcriptional repressor NrdR Streptomyces clavuligerus
Q9Z819 5.33e-39 132 46 1 142 3 nrdR Transcriptional repressor NrdR Chlamydia pneumoniae
Q8DY70 5.39e-39 132 44 0 147 3 nrdR Transcriptional repressor NrdR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E3T6 5.39e-39 132 44 0 147 3 nrdR Transcriptional repressor NrdR Streptococcus agalactiae serotype III (strain NEM316)
Q3JZR3 5.39e-39 132 44 0 147 3 nrdR Transcriptional repressor NrdR Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B5YAD3 7.2e-39 131 42 0 148 3 nrdR Transcriptional repressor NrdR Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A4YW96 7.59e-39 132 47 0 140 3 nrdR Transcriptional repressor NrdR Bradyrhizobium sp. (strain ORS 278)
A5EKI2 7.75e-39 132 47 0 140 3 nrdR Transcriptional repressor NrdR Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A7Z7I6 9.2e-39 131 47 0 147 3 nrdR Transcriptional repressor NrdR Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B7ID85 9.85e-39 131 42 0 149 3 nrdR Transcriptional repressor NrdR Thermosipho africanus (strain TCF52B)
B7JX64 1.27e-38 132 42 0 149 3 nrdR Transcriptional repressor NrdR Rippkaea orientalis (strain PCC 8801 / RF-1)
Q983B3 1.42e-38 131 46 0 148 3 nrdR Transcriptional repressor NrdR Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2GE55 1.52e-38 130 44 0 147 3 nrdR Transcriptional repressor NrdR Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
O69980 1.7e-38 131 43 1 149 1 nrdR Transcriptional repressor NrdR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q88WV2 1.79e-38 131 43 0 144 3 nrdR Transcriptional repressor NrdR Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q0C0I6 2.06e-38 130 50 0 144 3 nrdR Transcriptional repressor NrdR Hyphomonas neptunium (strain ATCC 15444)
Q049F5 2.09e-38 130 42 0 149 3 nrdR Transcriptional repressor NrdR Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9A5 2.09e-38 130 42 0 149 3 nrdR Transcriptional repressor NrdR Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A6X1Y8 2.43e-38 130 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B0T1I4 2.94e-38 130 47 0 142 3 nrdR Transcriptional repressor NrdR Caulobacter sp. (strain K31)
Q82KE1 2.95e-38 131 43 1 149 3 nrdR Transcriptional repressor NrdR Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q03GC0 3.17e-38 130 43 0 144 3 nrdR Transcriptional repressor NrdR Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B1XJ17 4.68e-38 130 41 0 149 3 nrdR Transcriptional repressor NrdR Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q11J94 4.74e-38 129 45 0 148 3 nrdR Transcriptional repressor NrdR Chelativorans sp. (strain BNC1)
B2UQD6 5.35e-38 130 45 0 148 3 nrdR Transcriptional repressor NrdR Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B8H533 5.7e-38 129 46 0 142 3 nrdR Transcriptional repressor NrdR Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A8J5 5.7e-38 129 46 0 142 3 nrdR Transcriptional repressor NrdR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q10VU2 5.83e-38 130 38 0 149 3 nrdR Transcriptional repressor NrdR Trichodesmium erythraeum (strain IMS101)
B8DSV1 6.35e-38 130 44 1 149 3 nrdR Transcriptional repressor NrdR Bifidobacterium animalis subsp. lactis (strain AD011)
Q03RK0 7.02e-38 129 43 0 144 3 nrdR Transcriptional repressor NrdR Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P67312 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella suis biovar 1 (strain 1330)
B0CL91 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VPU8 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P67311 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RIA3 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella melitensis biotype 2 (strain ATCC 23457)
A9MAE6 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57DY4 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella abortus biovar 1 (strain 9-941)
Q2YN94 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella abortus (strain 2308)
B2S514 8.69e-38 129 47 0 147 3 nrdR Transcriptional repressor NrdR Brucella abortus (strain S19)
B1WNA0 9.04e-38 130 42 0 149 3 nrdR Transcriptional repressor NrdR Crocosphaera subtropica (strain ATCC 51142 / BH68)
B1VXS9 1.12e-37 129 43 1 148 3 nrdR Transcriptional repressor NrdR Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B0BZ87 1.22e-37 129 42 0 149 3 nrdR Transcriptional repressor NrdR Acaryochloris marina (strain MBIC 11017)
Q2GHS3 1.35e-37 128 43 0 147 3 nrdR Transcriptional repressor NrdR Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q7NPB2 1.45e-37 129 44 0 144 3 nrdR Transcriptional repressor NrdR Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A5CS39 1.64e-37 128 42 1 148 3 nrdR Transcriptional repressor NrdR Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
A4TCN7 1.66e-37 128 45 1 148 3 nrdR Transcriptional repressor NrdR Mycolicibacterium gilvum (strain PYR-GCK)
B0RIK5 1.7e-37 128 42 1 148 3 nrdR Transcriptional repressor NrdR Clavibacter sepedonicus
P67323 1.7e-37 128 42 1 149 3 nrdR Transcriptional repressor NrdR Tropheryma whipplei (strain Twist)
P67324 1.7e-37 128 42 1 149 3 nrdR Transcriptional repressor NrdR Tropheryma whipplei (strain TW08/27)
Q251D2 1.85e-37 128 53 0 147 3 nrdR Transcriptional repressor NrdR Desulfitobacterium hafniense (strain Y51)
B8G0R5 1.85e-37 128 53 0 147 3 nrdR Transcriptional repressor NrdR Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B0JTA9 1.94e-37 129 43 0 148 3 nrdR Transcriptional repressor NrdR Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A9HHY9 2.37e-37 129 46 0 141 3 nrdR Transcriptional repressor NrdR Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q5FNA2 2.86e-37 128 44 0 148 3 nrdR Transcriptional repressor NrdR Gluconobacter oxydans (strain 621H)
Q8R605 3.57e-37 127 45 1 148 3 nrdR Transcriptional repressor NrdR Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5WEH3 3.67e-37 127 43 0 149 3 nrdR Transcriptional repressor NrdR Shouchella clausii (strain KSM-K16)
B1ZJM9 4.31e-37 128 46 0 147 3 nrdR Transcriptional repressor NrdR Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q1IWQ7 4.63e-37 127 43 1 148 3 nrdR Transcriptional repressor NrdR Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A9VYW5 4.81e-37 128 46 0 147 3 nrdR Transcriptional repressor NrdR Methylorubrum extorquens (strain PA1)
B7KUT4 4.81e-37 128 46 0 147 3 nrdR Transcriptional repressor NrdR Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q6AE77 4.98e-37 127 42 1 148 3 nrdR Transcriptional repressor NrdR Leifsonia xyli subsp. xyli (strain CTCB07)
C1B3A6 5.03e-37 127 43 1 149 3 nrdR Transcriptional repressor NrdR Rhodococcus opacus (strain B4)
Q0S1M4 5.03e-37 127 43 1 149 3 nrdR Transcriptional repressor NrdR Rhodococcus jostii (strain RHA1)
A1B2B8 5.03e-37 127 43 0 148 3 nrdR Transcriptional repressor NrdR Paracoccus denitrificans (strain Pd 1222)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_17280
Feature type CDS
Gene nrdR
Product transcriptional regulator NrdR
Location 7802 - 8251 (strand: -1)
Length 450 (nucleotides) / 149 (amino acids)

Contig

Accession ZDB_232
Length 42791 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2257
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03477 ATP cone domain
PF22811 Transcriptional repressor NrdR-like, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1327 Transcription (K) K Transcriptional regulator NrdR, contains Zn-ribbon and ATP-cone domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07738 transcriptional repressor NrdR - -

Protein Sequence

MHCPFCSAVDTKVIDSRLVGDGSQVRRRRQCLECHERFTTFEVAELVMPRVVKSDDSREPFDEEKLRRGMQKALEKRPVSSDDIETSLSHIKSQLRATGEREVSAKFVGELVMSELKKLDKVAYIRFASVYRSFEDIREFGEEIARLQD

Flanking regions ( +/- flanking 50bp)

TGTAAACAGGGTAAACTACCGCAACAGTTCATTGACCCGCAGGATAATTTATGCATTGCCCGTTTTGCTCCGCCGTTGATACCAAAGTCATCGACTCACGCCTGGTGGGTGATGGTTCTCAGGTCCGCCGCCGCCGTCAGTGCCTGGAATGCCACGAACGTTTTACCACGTTTGAGGTCGCCGAGCTGGTGATGCCGCGTGTGGTCAAAAGTGATGACAGCCGAGAACCGTTTGATGAAGAAAAACTGCGCCGCGGTATGCAGAAGGCGCTGGAAAAACGCCCCGTCAGCTCTGATGATATCGAAACCTCCCTCAGTCACATCAAATCGCAGTTACGGGCTACCGGCGAGCGGGAAGTCTCTGCTAAGTTTGTCGGCGAACTGGTGATGAGCGAGCTGAAAAAGCTGGATAAAGTCGCGTATATCCGCTTTGCCTCGGTTTACCGCAGTTTTGAGGATATCCGTGAATTCGGCGAGGAAATTGCCCGCCTGCAGGACTGAACATGATGCATTCTGATGAATTTTATATGGCCCGCGCCCTTGAACTGGCG