Homologs in group_2864

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10565 FBDBKF_10565 100.0 Morganella morganii S1 mtlD Mannitol-1-phosphate/altronate dehydrogenases
NLDBIP_14730 NLDBIP_14730 100.0 Morganella morganii S4 mtlD Mannitol-1-phosphate/altronate dehydrogenases
LHKJJB_14615 LHKJJB_14615 100.0 Morganella morganii S3 mtlD Mannitol-1-phosphate/altronate dehydrogenases
HKOGLL_13235 HKOGLL_13235 100.0 Morganella morganii S5 mtlD Mannitol-1-phosphate/altronate dehydrogenases
F4V73_RS14275 F4V73_RS14275 94.9 Morganella psychrotolerans - fructuronate reductase

Distribution of the homologs in the orthogroup group_2864

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2864

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P39160 0.0 703 69 1 484 3 uxuB D-mannonate oxidoreductase Escherichia coli (strain K12)
P33029 0.0 561 58 3 471 3 yeiQ Uncharacterized oxidoreductase YeiQ Escherichia coli (strain K12)
P77260 0.0 520 54 3 486 3 ydfI Uncharacterized oxidoreductase YdfI Escherichia coli (strain K12)
P0CX09 1.33e-118 360 40 7 490 1 MAN2 Mannitol dehydrogenase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CX08 1.33e-118 360 40 7 490 1 DSF1 Mannitol dehydrogenase DSF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0UEB6 3.54e-115 353 40 5 478 3 SNOG_09898 Mannitol 2-dehydrogenase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0CYP4 8.32e-108 332 38 6 457 3 ATEG_01190 Mannitol 2-dehydrogenase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q2U100 7.26e-107 330 39 6 457 3 AO090011000230 Mannitol 2-dehydrogenase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
B2W2N2 1.44e-106 331 38 7 484 3 PTRG_03680 Mannitol 2-dehydrogenase Pyrenophora tritici-repentis (strain Pt-1C-BFP)
Q4WQY4 6.07e-105 325 38 6 453 1 AFUA_4G14450 Mannitol 2-dehydrogenase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0Y581 6.07e-105 325 38 6 453 3 AFUB_071700 Mannitol 2-dehydrogenase Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
A4QQN1 2.62e-104 323 38 7 479 3 MGCH7_ch7g1113 Mannitol 2-dehydrogenase Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A1CVQ6 3.15e-104 323 39 7 453 3 NFIA_101920 Mannitol 2-dehydrogenase Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q5B9G5 2.41e-103 321 38 7 459 3 AN2815 Mannitol 2-dehydrogenase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A1CLZ5 5.84e-99 310 37 6 457 3 ACLA_078730 Mannitol 2-dehydrogenase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P80354 8.48e-97 303 38 4 414 1 por Polyol:NADP oxidoreductase Gluconobacter oxydans (strain 621H)
A2QGA1 3.76e-88 281 36 8 461 3 An03g02430 Mannitol 2-dehydrogenase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P33216 5.31e-88 280 37 6 448 1 mtlK Mannitol 2-dehydrogenase Cereibacter sphaeroides
P58708 2.06e-59 205 36 8 376 3 dalD D-arabinitol 4-dehydrogenase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P58709 3.43e-58 202 34 9 360 3 dalD D-arabinitol 4-dehydrogenase Yersinia pestis
O52720 3.73e-52 186 33 10 359 3 dalD D-arabinitol 4-dehydrogenase Klebsiella pneumoniae
Q47826 1.34e-51 177 49 2 208 3 None Uncharacterized oxidoreductase in tutB 3'region (Fragment) Enterobacter agglomerans
Q9WXS3 1.33e-37 147 28 18 461 1 uxuB D-mannonate oxidoreductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q97L67 4.73e-37 145 26 15 493 3 uxaB Altronate oxidoreductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9KFI7 9.93e-37 145 25 16 516 3 uxaB Altronate oxidoreductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8A9J0 4.98e-34 137 27 16 489 3 uxaB Altronate oxidoreductase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A6L4U5 5.66e-34 137 27 16 489 3 uxaB Altronate oxidoreductase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
O34354 1.02e-27 119 24 17 478 2 uxaB Altronate oxidoreductase Bacillus subtilis (strain 168)
Q8RCS0 5.85e-27 115 29 8 285 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A1JR24 3.8e-25 111 24 15 498 3 uxaB Altronate oxidoreductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7MPR2 4.59e-25 111 24 14 501 3 uxaB Altronate oxidoreductase Cronobacter sakazakii (strain ATCC BAA-894)
O65992 1.55e-24 108 28 7 280 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A4THM0 3.88e-24 108 24 16 500 3 uxaB Altronate oxidoreductase Yersinia pestis (strain Pestoides F)
Q1CMJ9 3.88e-24 108 24 16 500 3 uxaB Altronate oxidoreductase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZIC5 3.88e-24 108 24 16 500 3 uxaB Altronate oxidoreductase Yersinia pestis
A8AGR0 1.52e-23 106 24 15 495 3 uxaB Altronate oxidoreductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LRD0 2.26e-23 106 23 13 495 3 uxaB Altronate oxidoreductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q83RE1 3.34e-23 105 23 12 495 3 uxaB Altronate oxidoreductase Shigella flexneri
B7NIJ4 4.33e-23 105 23 13 495 3 uxaB Altronate oxidoreductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LF94 4.67e-23 105 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli (strain SMS-3-5 / SECEC)
P0A6L7 4.67e-23 105 23 12 495 1 uxaB Altronate oxidoreductase Escherichia coli (strain K12)
C4ZWT8 4.67e-23 105 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli (strain K12 / MC4100 / BW2952)
B5Z1X8 4.67e-23 105 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6L8 4.67e-23 105 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O157:H7
Q0T4K8 5.27e-23 105 23 12 495 3 uxaB Altronate oxidoreductase Shigella flexneri serotype 5b (strain 8401)
B7N4U6 5.89e-23 105 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B6IAS4 6.52e-23 104 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli (strain SE11)
B1IRT9 6.52e-23 104 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A074 6.52e-23 104 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O9:H4 (strain HS)
B7LZC3 6.52e-23 104 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O8 (strain IAI1)
B7L7M1 6.52e-23 104 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli (strain 55989 / EAEC)
A7ZLX7 6.52e-23 104 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0THR7 2.34e-22 103 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RBP6 2.72e-22 103 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli (strain UTI89 / UPEC)
A1ABA1 2.72e-22 103 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O1:K1 / APEC
B7MMY5 2.72e-22 103 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7URP8 2.72e-22 103 23 12 495 3 uxaB Altronate oxidoreductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3Z1Q7 1.57e-21 100 24 14 495 3 uxaB Altronate oxidoreductase Shigella sonnei (strain Ss046)
B0K280 1.62e-21 99 28 6 257 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Thermoanaerobacter sp. (strain X514)
B5XQU5 2.1e-21 100 24 14 500 3 uxaB Altronate oxidoreductase Klebsiella pneumoniae (strain 342)
A1JT46 2.54e-21 99 27 8 265 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q2NX35 7.17e-21 97 27 7 275 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Sodalis glossinidius (strain morsitans)
A8G7U3 7.52e-21 97 26 7 272 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Serratia proteamaculans (strain 568)
A6T900 8.12e-21 98 23 12 499 3 uxaB Altronate oxidoreductase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B0KCW3 2.29e-20 96 26 8 273 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
C6DKE8 2.55e-20 97 24 11 385 3 uxaB Altronate oxidoreductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B6EN80 5.33e-20 95 27 9 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Aliivibrio salmonicida (strain LFI1238)
A7FP92 1.18e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q663V5 1.22e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K7G3 1.22e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4TGP0 1.25e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pestis (strain Pestoides F)
Q1CD89 1.25e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R4F6 1.25e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pestis bv. Antiqua (strain Angola)
Q8Z9X0 1.25e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pestis
Q1C3J5 1.25e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pestis bv. Antiqua (strain Antiqua)
B1JH11 1.39e-19 94 26 7 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q5KYK6 1.64e-19 93 29 9 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Geobacillus kaustophilus (strain HTA426)
Q6D9G9 3.24e-19 94 24 11 385 3 uxaB Altronate oxidoreductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7MFG0 7.58e-19 91 26 10 285 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O45:K1 (strain S88 / ExPEC)
B5XMV6 1.39e-18 90 26 8 263 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Klebsiella pneumoniae (strain 342)
B5YW99 1.4e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDG9 1.4e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O157:H7
Q83PQ0 1.41e-18 90 26 11 286 1 mtlD Mannitol-1-phosphate 5-dehydrogenase Shigella flexneri
B6I3H6 1.41e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli (strain SE11)
B1IZJ2 1.41e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M3M7 1.41e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O8 (strain IAI1)
B7L723 1.41e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli (strain 55989 / EAEC)
A7ZTE9 1.41e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q9XBM6 1.43e-18 90 26 9 281 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Klebsiella pneumoniae
Q3YVW2 1.45e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Shigella sonnei (strain Ss046)
C4L274 1.45e-18 90 26 5 256 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A6TFJ4 1.55e-18 90 27 9 264 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B1LK35 1.85e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli (strain SMS-3-5 / SECEC)
Q8FCB7 1.85e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7N242 1.85e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O81 (strain ED1a)
B7ULF5 2.14e-18 90 26 10 285 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NEQ1 2.58e-18 90 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8A660 2.88e-18 90 26 10 281 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O9:H4 (strain HS)
A4WAF9 2.97e-18 90 23 15 497 3 uxaB Altronate oxidoreductase Enterobacter sp. (strain 638)
P09424 4.54e-18 89 26 10 281 1 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli (strain K12)
B1X8L4 4.54e-18 89 26 10 281 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli (strain K12 / DH10B)
C4ZXJ1 4.54e-18 89 26 10 281 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli (strain K12 / MC4100 / BW2952)
Q6DB14 5.26e-18 89 26 7 268 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5RGJ1 5.36e-18 89 27 11 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5B9 5.36e-18 89 27 11 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella enteritidis PT4 (strain P125109)
B5BHX1 7.07e-18 89 27 12 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella paratyphi A (strain AKU_12601)
Q5PLR3 7.07e-18 89 27 12 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZL67 7.48e-18 88 27 11 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MVI4 7.48e-18 88 27 11 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX95 7.48e-18 88 27 11 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella newport (strain SL254)
B5EX99 7.98e-18 88 27 10 281 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella agona (strain SL483)
Q8Z2E0 9.78e-18 88 27 11 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella typhi
A7MNE5 1.15e-17 88 24 5 254 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Cronobacter sakazakii (strain ATCC BAA-894)
Q31V29 1.16e-17 88 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Shigella boydii serotype 4 (strain Sb227)
B2U5B1 1.16e-17 88 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7NPA3 1.2e-17 88 26 11 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8DEF5 1.28e-17 88 26 8 281 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Vibrio vulnificus (strain CMCP6)
B4T977 1.58e-17 87 27 11 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella heidelberg (strain SL476)
B5FLG3 1.58e-17 87 27 11 282 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella dublin (strain CT_02021853)
A1RBC4 1.9e-17 87 26 10 308 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Paenarthrobacter aurescens (strain TC1)
B4TZT8 1.95e-17 87 27 10 275 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Salmonella schwarzengrund (strain CVM19633)
Q7MP60 5.33e-17 86 26 8 281 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Vibrio vulnificus (strain YJ016)
C6DII4 7.42e-17 85 25 7 268 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q65NA1 8.78e-17 85 28 9 287 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A8F9Z9 1.39e-16 84 28 10 250 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Bacillus pumilus (strain SAFR-032)
Q87SQ3 1.62e-16 84 26 13 325 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4IPF0 3.21e-16 84 29 7 230 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Geobacillus thermodenitrificans (strain NG80-2)
A7MWS7 3.41e-16 83 26 8 281 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Vibrio campbellii (strain ATCC BAA-1116)
C4L8P4 1.26e-15 82 26 9 286 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q9CJH1 2.19e-15 81 24 7 257 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Lactococcus lactis subsp. lactis (strain IL1403)
P42957 2.7e-15 80 26 12 287 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Bacillus subtilis (strain 168)
A4SS45 2.74e-15 80 27 11 294 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Aeromonas salmonicida (strain A449)
Q45421 3.74e-15 80 26 11 302 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Geobacillus stearothermophilus
Q02418 4.4e-15 80 24 5 252 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A7Z1E8 5.61e-15 80 26 13 337 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A0K258 5.76e-15 80 31 9 224 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Arthrobacter sp. (strain FB24)
Q6AHH7 5.83e-15 80 28 11 300 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Leifsonia xyli subsp. xyli (strain CTCB07)
Q9CLY7 1.51e-14 79 25 7 252 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Pasteurella multocida (strain Pm70)
A3N2S7 2.2e-14 78 26 12 314 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BRV5 2.34e-14 78 26 12 315 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2M6 2.34e-14 78 26 12 315 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B8H7T9 2.52e-14 78 25 11 295 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
B1YHJ8 3.78e-14 77 28 9 236 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B2AND4 4.58e-14 77 24 16 402 3 Pa_6_10260 Mannitol-1-phosphate 5-dehydrogenase Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
C0Z8I6 5.08e-14 77 28 8 240 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q033M9 6.01e-14 77 24 5 244 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WBT3 6.13e-14 77 24 5 244 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Lacticaseibacillus casei (strain BL23)
Q49ZA6 6.47e-14 76 23 8 276 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q033G3 1.19e-13 75 23 8 292 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Lactococcus lactis subsp. cremoris (strain SK11)
B2WME4 1.33e-13 75 23 18 414 3 PTRG_11154 Mannitol-1-phosphate 5-dehydrogenase Pyrenophora tritici-repentis (strain Pt-1C-BFP)
C1CCG5 1.34e-13 75 21 12 396 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae (strain JJA)
A2RH97 1.47e-13 75 23 6 256 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Lactococcus lactis subsp. cremoris (strain MG1363)
B2VCH7 1.48e-13 75 24 6 269 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q88ZS1 1.93e-13 75 24 7 257 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B1I9J3 2.23e-13 75 21 12 396 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae (strain Hungary19A-6)
Q6LKE5 2.68e-13 75 25 8 259 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Photobacterium profundum (strain SS9)
Q9K681 3.01e-13 74 24 7 256 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8DR31 3.81e-13 74 20 12 397 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04M75 3.81e-13 74 20 12 397 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B2ILU3 4.02e-13 74 20 12 397 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae (strain CGSP14)
B5E7E0 4.02e-13 74 20 12 397 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae serotype 19F (strain G54)
C1C5D6 4.13e-13 74 21 12 396 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae (strain 70585)
P27543 9.07e-13 73 27 8 248 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Enterococcus faecalis (strain ATCC 700802 / V583)
B8ZLG6 1.09e-12 73 21 12 396 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
A1SR48 1.2e-12 72 25 8 267 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q97SH1 1.28e-12 72 21 12 396 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q0U6E8 1.29e-12 72 23 16 377 2 mpd1 Mannitol-1-phosphate 5-dehydrogenase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q65VJ3 1.37e-12 72 22 8 257 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B6QP49 1.71e-12 72 25 13 335 3 PMAA_048060 Mannitol-1-phosphate 5-dehydrogenase Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
B7GJR4 1.86e-12 72 29 9 232 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q6UQ76 3.55e-12 71 23 16 399 3 None Mannitol-1-phosphate 5-dehydrogenase Alternaria alternata
Q1WRQ9 5.2e-12 70 23 7 259 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Ligilactobacillus salivarius (strain UCC118)
Q7SA44 1.61e-11 69 22 14 412 3 NCU07318 Mannitol-1-phosphate 5-dehydrogenase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P57634 1.62e-11 69 23 7 242 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5WDV0 2.32e-11 68 25 9 263 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Shouchella clausii (strain KSM-K16)
B8D892 3.27e-11 68 22 7 242 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8D5 3.33e-11 68 22 6 241 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B9DM96 5.2e-11 67 24 9 269 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus carnosus (strain TM300)
Q6GER8 5.37e-11 67 27 6 176 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain MRSA252)
C3LWV8 7.7e-11 67 24 8 245 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Vibrio cholerae serotype O1 (strain M66-2)
Q9KKQ6 7.7e-11 67 24 8 245 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F155 7.7e-11 67 24 8 245 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A8YYC5 7.91e-11 67 27 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain USA300 / TCH1516)
A6QJ00 7.91e-11 67 27 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain Newman)
Q9RL68 7.91e-11 67 27 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain COL)
Q2FEX4 7.91e-11 67 27 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain USA300)
Q8K912 1.09e-10 67 21 6 247 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P63956 1.74e-10 66 26 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain MW2)
Q6G7F3 1.74e-10 66 26 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain MSSA476)
P99140 1.74e-10 66 26 6 175 1 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain N315)
P63955 1.74e-10 66 26 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IUU9 1.74e-10 66 26 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain JH9)
A6U3N9 1.74e-10 66 26 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain JH1)
A7X522 1.74e-10 66 26 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2FW96 2.13e-10 65 26 6 175 1 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5B0F5 2.67e-10 65 23 9 251 3 mpdA Mannitol-1-phosphate 5-dehydrogenase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A1C6B4 3.46e-10 65 25 8 245 3 mpdA Mannitol-1-phosphate 5-dehydrogenase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q8NJJ1 4.99e-10 64 22 12 336 1 mpdA Mannitol-1-phosphate 5-dehydrogenase Aspergillus niger
A2QD49 7.14e-10 64 21 14 377 3 mpdA Mannitol-1-phosphate 5-dehydrogenase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q0CXS6 1.2e-09 63 23 7 238 3 mpdA Mannitol-1-phosphate 5-dehydrogenase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q8EN87 1.45e-09 63 25 9 237 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q2YYE8 1.66e-09 63 26 6 175 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2U059 3.03e-09 62 21 14 337 3 mpdA Mannitol-1-phosphate 5-dehydrogenase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A7F8U1 3.29e-09 62 24 5 204 3 SS1G_14022 Mannitol-1-phosphate 5-dehydrogenase Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q89A37 5.84e-09 61 23 8 250 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1DGY9 6.06e-09 61 22 7 245 3 mpdA Mannitol-1-phosphate 5-dehydrogenase Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q4X1A4 6.06e-09 61 22 7 245 1 mpdA Mannitol-1-phosphate 5-dehydrogenase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0XS99 6.06e-09 61 22 7 245 3 mpdA Mannitol-1-phosphate 5-dehydrogenase Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Q2H2D7 6.06e-09 61 23 18 401 3 CHGG_04059 Mannitol-1-phosphate 5-dehydrogenase Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q1DP56 6.1e-08 58 20 15 401 3 CIMG_07907 Mannitol-1-phosphate 5-dehydrogenase Coccidioides immitis (strain RS)
Q4L9Y4 7.46e-08 58 22 8 258 3 mtlD Mannitol-1-phosphate 5-dehydrogenase Staphylococcus haemolyticus (strain JCSC1435)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_14900
Feature type CDS
Gene mtlD
Product Mannitol-1-phosphate/altronate dehydrogenases
Location 72583 - 74049 (strand: 1)
Length 1467 (nucleotides) / 488 (amino acids)
In genomic island -

Contig

Accession ZDB_225
Length 129223 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2864
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01232 Mannitol dehydrogenase Rossmann domain
PF08125 Mannitol dehydrogenase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0246 Carbohydrate transport and metabolism (G) G Mannitol-1-phosphate/altronate dehydrogenases

Kegg Ortholog Annotation(s)

Protein Sequence

MEKNLVTADITATRPDWTTDRLTTRIVHLGCGAFHRAHQALYTHHVLEKTDSDWGYCEVNLMSAQDAALIEGLKAQSMLYTVAEKGADKTELKIIGSMKEAMHPLIDGIDAVIEKMASPDVSIVSLTVTEKGYCTDPATGQLDPENALIKQDLATPETPRSAIGYITAALKRRRERGLPPFTVLSCDNVRENGHVAREAVLGLARLQDPALAAWIEANVTFPCTMVDRIVPAATPETLAEIAQLLGTEDNCAIACEPFRQWVIEDNFVNGRPEWDCAGAQFVQDVVPFELMKLRMLNGSHSFLAYLGYLGGYAHISDTMTNPDYRKAARALMLDEQAPTLTMPEETDLVAYADNLIDRFTNPSLKHQTWQIAMDGSQKLPQRLLDPVAQHIADGSDYRHLVLGVAGWMRYVSGTDEQGNKIDVRDPLAETFAAIYAKHGLSVAVVDELLAIESIFGNELPKQQGFVDAVKRAYQQLLDVGARQAVAAL

Flanking regions ( +/- flanking 50bp)

CCTGCCGGGCTGCGGGATCTCTCCCGCAGCCTGCTCCCCGGGAGCCTGTAATGGAAAAGAATCTTGTCACTGCGGACATCACCGCAACGCGTCCTGACTGGACGACTGATCGTCTCACCACCCGTATTGTTCACCTCGGCTGCGGCGCGTTTCACCGCGCACATCAGGCGCTGTATACCCATCACGTATTAGAAAAAACAGACAGCGACTGGGGTTACTGCGAAGTTAACCTGATGTCGGCACAGGATGCGGCACTGATCGAAGGGCTGAAAGCCCAGTCCATGCTGTATACCGTGGCGGAGAAAGGGGCGGATAAAACAGAGCTGAAAATTATCGGTTCAATGAAGGAAGCGATGCACCCGCTGATCGACGGTATTGATGCGGTGATTGAGAAAATGGCGTCTCCGGATGTTAGTATTGTTTCCCTGACTGTGACCGAAAAAGGCTACTGCACCGATCCGGCGACCGGGCAGCTTGACCCGGAAAATGCACTGATTAAACAGGATCTGGCCACACCGGAGACCCCGCGCTCTGCTATCGGCTACATCACTGCAGCACTGAAACGCCGTCGTGAACGCGGTCTGCCGCCGTTTACTGTGCTCTCCTGTGACAACGTCCGTGAGAATGGTCATGTTGCCCGTGAAGCCGTACTCGGCCTGGCGCGGTTACAGGATCCGGCGCTGGCGGCGTGGATTGAAGCCAATGTTACTTTCCCGTGCACGATGGTTGACCGTATTGTTCCGGCGGCCACCCCGGAAACACTGGCGGAAATCGCGCAGCTTCTGGGAACAGAGGATAACTGTGCTATCGCCTGTGAGCCGTTCCGTCAGTGGGTGATTGAAGATAATTTTGTCAACGGCCGTCCTGAGTGGGATTGCGCCGGTGCGCAGTTTGTGCAGGATGTGGTGCCGTTTGAATTAATGAAGCTGCGGATGCTCAACGGCAGTCACTCCTTCCTGGCGTATCTCGGCTATCTCGGCGGTTATGCCCATATTTCCGATACCATGACCAACCCGGATTACCGCAAAGCTGCCCGTGCACTGATGCTGGATGAGCAGGCGCCGACCCTCACCATGCCGGAAGAAACCGACCTGGTCGCCTATGCGGATAACCTGATTGACCGCTTTACCAATCCGTCCCTGAAACACCAGACATGGCAGATTGCGATGGACGGCAGCCAGAAGCTTCCGCAGCGTCTGCTGGACCCGGTCGCACAGCATATCGCGGACGGCAGCGATTATCGTCATTTGGTGCTGGGTGTGGCGGGCTGGATGCGTTATGTCAGCGGCACCGATGAGCAGGGCAACAAAATCGATGTGCGTGACCCGCTGGCAGAAACCTTCGCGGCAATCTACGCAAAACACGGCCTGTCTGTGGCGGTGGTGGATGAACTGCTGGCAATTGAATCCATTTTCGGTAACGAGCTGCCGAAACAGCAGGGCTTTGTTGATGCGGTGAAGCGCGCGTATCAGCAGTTACTTGATGTCGGTGCCCGTCAGGCCGTTGCCGCACTGTAATCCCGGAGAGTTTATGAAACAGTTTCTTTGCGAAGATTTTTTACTGCACA