Homologs in group_2196

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16550 FBDBKF_16550 100.0 Morganella morganii S1 upp uracil phosphoribosyltransferase
NLDBIP_08740 NLDBIP_08740 100.0 Morganella morganii S4 upp uracil phosphoribosyltransferase
LHKJJB_05525 LHKJJB_05525 100.0 Morganella morganii S3 upp uracil phosphoribosyltransferase
HKOGLL_05390 HKOGLL_05390 100.0 Morganella morganii S5 upp uracil phosphoribosyltransferase
F4V73_RS03070 F4V73_RS03070 97.1 Morganella psychrotolerans upp uracil phosphoribosyltransferase
PMI_RS07670 PMI_RS07670 90.9 Proteus mirabilis HI4320 upp uracil phosphoribosyltransferase

Distribution of the homologs in the orthogroup group_2196

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2196

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EY88 5.23e-140 392 90 0 208 3 upp Uracil phosphoribosyltransferase Proteus mirabilis (strain HI4320)
Q7N3F8 2.41e-137 385 88 0 208 3 upp Uracil phosphoribosyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D7S0 5.6e-137 384 89 0 208 3 upp Uracil phosphoribosyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6TCB0 1.29e-136 384 88 0 208 1 upp Uracil phosphoribosyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C6DBR1 2.11e-136 383 88 0 208 3 upp Uracil phosphoribosyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5XNQ4 9.6e-136 381 88 0 208 3 upp Uracil phosphoribosyltransferase Klebsiella pneumoniae (strain 342)
A1JKZ8 1.12e-135 381 89 0 208 3 upp Uracil phosphoribosyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4WD70 1.25e-135 381 88 0 208 3 upp Uracil phosphoribosyltransferase Enterobacter sp. (strain 638)
P0A8F3 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Shigella flexneri
Q0T222 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Shigella flexneri serotype 5b (strain 8401)
B2TXS3 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LNE8 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6I570 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain SE11)
B7N680 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8F0 2.28e-135 380 87 0 208 1 upp Uracil phosphoribosyltransferase Escherichia coli (strain K12)
B1IWG2 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8F1 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEZ0 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADZ1 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O1:K1 / APEC
A8A2Z0 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O9:H4 (strain HS)
B1XAX3 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain K12 / DH10B)
C4ZX73 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7K2 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O8 (strain IAI1)
B7MYC5 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O81 (strain ED1a)
B7NQN7 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z035 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8F2 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O157:H7
B7LCN8 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli (strain 55989 / EAEC)
B7MHX9 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UGN6 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZPU1 2.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
P0A2M5 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2M6 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella typhi
B4TR74 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella schwarzengrund (strain CVM19633)
B5BB06 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella paratyphi A (strain AKU_12601)
C0PYQ8 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella paratyphi C (strain RKS4594)
A9N2Y1 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PNJ7 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0M7 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella newport (strain SL254)
B4TD73 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella heidelberg (strain SL476)
B5RCX0 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R560 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FQJ0 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella dublin (strain CT_02021853)
Q57LL1 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella choleraesuis (strain SC-B67)
A9MHP1 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F173 3.28e-135 380 87 0 208 3 upp Uracil phosphoribosyltransferase Salmonella agona (strain SL483)
B1JSF5 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668E6 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMP2 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis (strain Pestoides F)
Q1CK39 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZW6 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCX9 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis
B2K9J9 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5P3 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FG38 4.04e-135 380 88 0 208 3 upp Uracil phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5BHQ5 6.19e-135 379 88 0 208 3 upp Uracil phosphoribosyltransferase Edwardsiella ictaluri (strain 93-146)
A8AD93 7.54e-135 379 88 0 208 3 upp Uracil phosphoribosyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LKE4 1.7e-134 378 87 0 208 3 upp Uracil phosphoribosyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q2NS69 2.19e-131 370 87 0 208 3 upp Uracil phosphoribosyltransferase Sodalis glossinidius (strain morsitans)
Q65RC3 7.82e-131 369 85 0 208 3 upp Uracil phosphoribosyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VQ76 1.96e-130 368 85 0 208 3 upp Uracil phosphoribosyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B8CN81 2.45e-130 367 85 0 208 3 upp Uracil phosphoribosyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q9CPL8 2.79e-130 367 83 0 208 3 upp Uracil phosphoribosyltransferase Pasteurella multocida (strain Pm70)
Q87MH1 3.15e-130 367 85 0 208 3 upp Uracil phosphoribosyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q12MF1 4.52e-130 367 85 0 208 3 upp Uracil phosphoribosyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4SL29 5.69e-130 367 84 0 208 3 upp Uracil phosphoribosyltransferase Aeromonas salmonicida (strain A449)
C3LPM9 1.01e-129 366 84 0 208 3 upp Uracil phosphoribosyltransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F642 1.01e-129 366 84 0 208 3 upp Uracil phosphoribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A0KM23 1.03e-129 366 84 0 208 3 upp Uracil phosphoribosyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A3QD33 1.78e-129 365 84 0 208 3 upp Uracil phosphoribosyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B0BTQ3 1.78e-129 365 84 0 208 3 upp Uracil phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H0R2 1.78e-129 365 84 0 208 3 upp Uracil phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZB6 1.78e-129 365 84 0 208 3 upp Uracil phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B6EJU2 1.8e-129 365 84 0 208 3 upp Uracil phosphoribosyltransferase Aliivibrio salmonicida (strain LFI1238)
Q7MIK2 2.47e-129 365 84 0 208 3 upp Uracil phosphoribosyltransferase Vibrio vulnificus (strain YJ016)
A8H5Q9 2.82e-129 365 85 0 208 3 upp Uracil phosphoribosyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TPW8 2.82e-129 365 85 0 208 3 upp Uracil phosphoribosyltransferase Shewanella halifaxensis (strain HAW-EB4)
B0UW86 5.16e-129 364 84 0 208 3 upp Uracil phosphoribosyltransferase Histophilus somni (strain 2336)
Q0I4P2 5.16e-129 364 84 0 208 3 upp Uracil phosphoribosyltransferase Histophilus somni (strain 129Pt)
Q6LN74 6.56e-129 364 84 0 208 3 upp Uracil phosphoribosyltransferase Photobacterium profundum (strain SS9)
Q9KPY7 8.09e-129 364 84 0 208 3 upp Uracil phosphoribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5FGY4 1.21e-128 363 84 0 208 3 upp Uracil phosphoribosyltransferase Aliivibrio fischeri (strain MJ11)
Q084L0 1.92e-128 363 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella frigidimarina (strain NCIMB 400)
A0KYA2 9.96e-128 361 84 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sp. (strain ANA-3)
A9KY39 1.43e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella baltica (strain OS195)
A6WM35 1.43e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella baltica (strain OS185)
A3D3D2 1.43e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAL3 1.43e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella baltica (strain OS223)
A1RKQ4 1.7e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sp. (strain W3-18-1)
A4Y5T9 1.7e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1S7E5 2.32e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q0HTW9 3.52e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sp. (strain MR-7)
Q0HHL7 3.52e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sp. (strain MR-4)
Q8EDI9 3.52e-127 360 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B1KIG8 5.16e-127 359 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q7VM34 5.63e-127 359 82 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C4LC66 8.64e-127 358 82 0 208 3 upp Uracil phosphoribosyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P43857 1.24e-126 358 81 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UF76 1.24e-126 358 81 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus influenzae (strain PittGG)
A5UBP1 1.24e-126 358 81 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus influenzae (strain PittEE)
B8F5N2 5.63e-126 357 81 0 208 3 upp Uracil phosphoribosyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
Q4QJV5 1.14e-125 356 81 0 208 3 upp Uracil phosphoribosyltransferase Haemophilus influenzae (strain 86-028NP)
A8FUD4 2.03e-125 355 83 0 208 3 upp Uracil phosphoribosyltransferase Shewanella sediminis (strain HAW-EB3)
A1SVA9 3.05e-124 352 80 0 208 3 upp Uracil phosphoribosyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q492F3 1.11e-116 333 75 0 208 3 upp Uracil phosphoribosyltransferase Blochmanniella pennsylvanica (strain BPEN)
A1AMK6 7.7e-113 323 72 0 208 3 upp Uracil phosphoribosyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B3E677 1.12e-112 323 71 0 208 3 upp Uracil phosphoribosyltransferase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q1IEV9 3.62e-109 314 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas entomophila (strain L48)
B1JEN1 6.06e-109 313 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas putida (strain W619)
Q47W53 1.43e-108 313 70 0 208 3 upp Uracil phosphoribosyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q88PV2 1.92e-108 312 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KNF7 1.92e-108 312 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas putida (strain GB-1)
A5VYH8 1.92e-108 312 71 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q7VRS9 3.67e-108 311 75 0 208 3 upp Uracil phosphoribosyltransferase Blochmanniella floridana
C1DC78 4.79e-108 311 66 0 208 3 upp Uracil phosphoribosyltransferase Laribacter hongkongensis (strain HLHK9)
Q7NS06 3.8e-107 309 66 0 208 3 upp Uracil phosphoribosyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A4VPB2 7.94e-107 308 69 0 208 3 upp Uracil phosphoribosyltransferase Stutzerimonas stutzeri (strain A1501)
C6BSG3 9e-107 308 71 0 208 3 upp Uracil phosphoribosyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C0QHT9 1.07e-106 308 69 0 208 3 upp Uracil phosphoribosyltransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q4K6B5 1.81e-106 307 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A4XQU8 3.09e-106 307 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas mendocina (strain ymp)
Q311Z9 4.04e-106 306 68 0 208 3 upp Uracil phosphoribosyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B8DP34 5.31e-106 306 68 0 208 3 upp Uracil phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
P59001 9.62e-106 305 68 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas axonopodis pv. citri (strain 306)
C1DEU0 1.09e-105 305 69 0 208 3 upp Uracil phosphoribosyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q9RBJ3 1.2e-105 305 68 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RRQ3 1.2e-105 305 68 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UVY0 1.2e-105 305 68 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q2P2V7 2.12e-105 305 67 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3K6Y9 2.76e-105 304 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q4ZXU7 2.79e-105 304 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q48MT3 2.79e-105 304 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1QVR2 3.24e-105 304 68 1 209 3 upp Uracil phosphoribosyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
C3KAJ8 5.82e-105 303 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas fluorescens (strain SBW25)
Q888A0 6.94e-105 303 68 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3BS29 1.47e-104 302 67 0 208 3 upp Uracil phosphoribosyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B4SS22 5.6e-104 301 66 0 208 3 upp Uracil phosphoribosyltransferase Stenotrophomonas maltophilia (strain R551-3)
B2FLX2 9.27e-104 300 66 0 208 3 upp Uracil phosphoribosyltransferase Stenotrophomonas maltophilia (strain K279a)
Q3IC38 1.37e-103 300 68 1 208 3 upp Uracil phosphoribosyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q6AQH2 1.48e-103 300 70 0 201 3 upp Uracil phosphoribosyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9HVE6 2.87e-103 299 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02G28 2.87e-103 299 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V0J2 2.87e-103 299 69 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas aeruginosa (strain LESB58)
A1VEW8 3.37e-103 299 67 0 208 3 upp Uracil phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72DA4 3.37e-103 299 67 0 208 3 upp Uracil phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C4XJX5 3.63e-103 299 68 0 208 3 upp Uracil phosphoribosyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B2SDI9 3.97e-103 299 68 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IZ90 1.12e-102 298 68 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NGW1 1.12e-102 298 68 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q5K6 1.12e-102 298 68 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. novicida (strain U112)
A1U241 1.17e-102 298 67 0 208 3 upp Uracil phosphoribosyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A6VC42 1.39e-102 298 68 0 208 3 upp Uracil phosphoribosyltransferase Pseudomonas aeruginosa (strain PA7)
Q2SN06 2.38e-102 297 66 0 208 3 upp Uracil phosphoribosyltransferase Hahella chejuensis (strain KCTC 2396)
Q2A285 5.39e-102 296 68 1 209 3 upp Uracil phosphoribosyltransferase Francisella tularensis subsp. holarctica (strain LVS)
Q9JV58 7.55e-102 295 65 0 208 3 upp Uracil phosphoribosyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B0TYR5 9.21e-102 295 68 1 209 3 upp Uracil phosphoribosyltransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q9K048 1.25e-101 295 65 0 208 3 upp Uracil phosphoribosyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KT34 3.82e-101 294 65 0 208 3 upp Uracil phosphoribosyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M3K6 3.82e-101 294 65 0 208 3 upp Uracil phosphoribosyltransferase Neisseria meningitidis serogroup C (strain 053442)
A2SGT8 1.54e-100 292 64 0 208 3 upp Uracil phosphoribosyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A9HZV9 3.25e-100 291 65 0 208 3 upp Uracil phosphoribosyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B4RK50 5.41e-100 291 64 0 208 3 upp Uracil phosphoribosyltransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F9P0 5.41e-100 291 64 0 208 3 upp Uracil phosphoribosyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q2KWB3 4.92e-99 288 64 0 208 3 upp Uracil phosphoribosyltransferase Bordetella avium (strain 197N)
B8IZH6 5.64e-99 288 64 0 208 3 upp Uracil phosphoribosyltransferase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q7VZ79 1.32e-98 288 63 0 207 3 upp Uracil phosphoribosyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WB58 7.6e-98 286 62 0 207 3 upp Uracil phosphoribosyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMM5 7.6e-98 286 62 0 207 3 upp Uracil phosphoribosyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6FE58 2e-96 282 63 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
C6DZH8 2.51e-96 281 63 1 209 3 upp Uracil phosphoribosyltransferase Geobacter sp. (strain M21)
Q15ZS0 7.94e-96 280 67 1 209 3 upp Uracil phosphoribosyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0V8B1 8.98e-96 280 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain AYE)
B0VU43 8.98e-96 280 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain SDF)
B2HU54 8.98e-96 280 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain ACICU)
B7I752 8.98e-96 280 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain AB0057)
B7GZA8 8.98e-96 280 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain AB307-0294)
A3M2R1 9.91e-96 280 62 0 207 3 upp Uracil phosphoribosyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B5EBM3 2.37e-95 279 63 1 209 3 upp Uracil phosphoribosyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q74EM9 5.62e-89 263 65 1 209 3 upp Uracil phosphoribosyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q9CEC9 1.91e-83 249 58 1 205 3 upp Uracil phosphoribosyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q38WJ8 4.42e-83 248 55 0 207 3 upp Uracil phosphoribosyltransferase Latilactobacillus sakei subsp. sakei (strain 23K)
Q93CX7 4.42e-83 248 55 0 207 3 upp Uracil phosphoribosyltransferase Latilactobacillus sakei
P50926 8.81e-83 247 57 1 205 3 upp Uracil phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q02WM7 9.94e-83 247 57 1 205 3 upp Uracil phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q04DP1 2.41e-82 246 56 0 207 3 upp Uracil phosphoribosyltransferase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
B9E8F4 9.65e-82 244 57 0 207 3 upp Uracil phosphoribosyltransferase Macrococcus caseolyticus (strain JCSC5402)
Q5KUI3 1.61e-81 244 55 0 207 3 upp Uracil phosphoribosyltransferase Geobacillus kaustophilus (strain HTA426)
Q927V5 1.76e-81 244 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q97RQ3 2.01e-81 244 55 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DQI3 2.14e-81 244 55 0 207 3 upp Uracil phosphoribosyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B9DTU7 2.44e-81 244 56 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A0ALM3 5.2e-81 243 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y4B3 5.2e-81 243 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DBH1 5.2e-81 243 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q71WP0 5.2e-81 243 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KYV5 5.2e-81 243 56 0 203 3 upp Uracil phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
A3CPK9 6.26e-81 243 56 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus sanguinis (strain SK36)
P0DH35 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48V26 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RG73 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J888 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JID6 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JN85 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
P67402 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDM5 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DH34 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P67400 6.76e-81 243 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M1
A8AYQ0 7.79e-81 242 56 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P36399 9.08e-81 242 56 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus salivarius
Q03A25 9.91e-81 242 55 0 207 3 upp Uracil phosphoribosyltransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WDL1 9.91e-81 242 55 0 207 3 upp Uracil phosphoribosyltransferase Lacticaseibacillus casei (strain BL23)
Q9K6G5 1e-80 242 54 0 207 3 upp Uracil phosphoribosyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q03EK5 1.29e-80 242 57 0 201 3 upp Uracil phosphoribosyltransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
C0MGT4 1.6e-80 241 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus equi subsp. zooepidemicus (strain H70)
B4U4M9 1.6e-80 241 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M7M9 1.6e-80 241 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus equi subsp. equi (strain 4047)
Q03QY1 1.79e-80 241 54 0 201 3 upp Uracil phosphoribosyltransferase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q9RE01 2.46e-80 241 54 0 201 3 upp Uracil phosphoribosyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C4Z9S1 4.78e-80 240 55 0 207 3 upp Uracil phosphoribosyltransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q03M79 5.05e-80 240 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5U5 5.05e-80 240 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1A9 5.05e-80 240 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus thermophilus (strain CNRZ 1066)
Q8DST6 6.02e-80 240 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P67399 9.63e-80 239 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67398 9.63e-80 239 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q3JZU9 9.63e-80 239 55 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q67TC9 1.01e-79 239 52 0 207 3 upp Uracil phosphoribosyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8XIC4 1.13e-79 239 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium perfringens (strain 13 / Type A)
Q0TNB4 1.13e-79 239 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A6LQG6 1.16e-79 239 54 0 207 3 upp Uracil phosphoribosyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q0SQY5 1.41e-79 239 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium perfringens (strain SM101 / Type A)
B2TJY9 1.59e-79 239 54 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
B2UZI9 1.59e-79 239 54 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Alaska E43 / Type E3)
C5D9M4 1.66e-79 239 54 0 207 3 upp Uracil phosphoribosyltransferase Geobacillus sp. (strain WCH70)
B5XJZ7 2.26e-79 239 54 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus pyogenes serotype M49 (strain NZ131)
P70881 3.42e-79 238 54 0 207 1 upp Uracil phosphoribosyltransferase Bacillus caldolyticus
Q97F73 4.17e-79 238 54 0 207 3 upp Uracil phosphoribosyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q1WUD3 7.68e-79 237 53 0 201 3 upp Uracil phosphoribosyltransferase Ligilactobacillus salivarius (strain UCC118)
Q831G0 1.09e-78 237 54 0 203 3 upp Uracil phosphoribosyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
A4VWM9 1.27e-78 237 54 0 203 3 upp Uracil phosphoribosyltransferase Streptococcus suis (strain 05ZYH33)
Q04BB0 2.4e-78 236 55 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAX2 2.4e-78 236 55 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q9RGY8 7.07e-78 235 56 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5WB67 9.6e-78 234 53 0 207 3 upp Uracil phosphoribosyltransferase Shouchella clausii (strain KSM-K16)
B7GMG3 1.55e-77 234 53 0 207 3 upp Uracil phosphoribosyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A0Q306 3.12e-77 233 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium novyi (strain NT)
Q180X8 3.56e-77 233 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridioides difficile (strain 630)
A1B467 1.15e-76 232 53 0 203 3 upp Uracil phosphoribosyltransferase Paracoccus denitrificans (strain Pd 1222)
B2G680 1.32e-76 232 53 1 203 3 upp Uracil phosphoribosyltransferase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIQ0 1.32e-76 232 53 1 203 3 upp Uracil phosphoribosyltransferase Limosilactobacillus reuteri (strain DSM 20016)
B1HM47 1.59e-76 231 52 0 207 3 upp Uracil phosphoribosyltransferase Lysinibacillus sphaericus (strain C3-41)
A5N3J1 4.21e-76 230 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DX75 4.21e-76 230 52 0 207 3 upp Uracil phosphoribosyltransferase Clostridium kluyveri (strain NBRC 12016)
A8YUJ4 8.56e-76 229 54 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus helveticus (strain DPC 4571)
B0S2A9 8.75e-76 229 50 0 207 3 upp Uracil phosphoribosyltransferase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
B0K1G2 1.6e-75 229 52 0 207 3 upp Uracil phosphoribosyltransferase Thermoanaerobacter sp. (strain X514)
B0K7G1 1.6e-75 229 52 0 207 3 upp Uracil phosphoribosyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
C0Z818 1.99e-75 229 50 0 207 3 upp Uracil phosphoribosyltransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q8CRN4 2.03e-75 229 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMB1 2.03e-75 229 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P39149 3.78e-75 228 54 0 207 3 upp Uracil phosphoribosyltransferase Bacillus subtilis (strain 168)
Q7M8H6 5.03e-75 228 52 0 208 3 upp Uracil phosphoribosyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8RD94 5.55e-75 228 52 0 207 3 upp Uracil phosphoribosyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q65DW6 5.99e-75 228 53 0 207 3 upp Uracil phosphoribosyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q898X9 6.61e-75 227 53 0 207 3 upp Uracil phosphoribosyltransferase Clostridium tetani (strain Massachusetts / E88)
B9J6V7 6.98e-75 227 54 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A8MJX1 9.37e-75 227 50 0 207 3 upp Uracil phosphoribosyltransferase Alkaliphilus oremlandii (strain OhILAs)
A7GV65 1.1e-74 227 51 0 201 3 upp Uracil phosphoribosyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5SIQ7 1.27e-74 226 51 0 208 3 upp Uracil phosphoribosyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72J35 1.27e-74 226 51 0 208 1 upp Uracil phosphoribosyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q24MM7 1.33e-74 226 50 0 207 3 upp Uracil phosphoribosyltransferase Desulfitobacterium hafniense (strain Y51)
B8FZ68 1.33e-74 226 50 0 207 3 upp Uracil phosphoribosyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B9JYP9 1.4e-74 226 53 0 206 3 upp Uracil phosphoribosyltransferase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A6TK51 1.67e-74 226 50 0 207 3 upp Uracil phosphoribosyltransferase Alkaliphilus metalliredigens (strain QYMF)
A9VSB3 1.97e-74 226 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus mycoides (strain KBAB4)
A0RLA2 1.97e-74 226 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus thuringiensis (strain Al Hakam)
B1KSR7 3.02e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
A7G9P8 3.02e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE69 3.02e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Okra / Type B1)
C1FQA3 3.02e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Kyoto / Type A2)
A5HY41 3.02e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYI1 3.02e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain 657 / Type Ba4)
A7FQG8 3.02e-74 226 51 0 207 3 upp Uracil phosphoribosyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
B5ZXI2 3.22e-74 226 53 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B3PXN0 4.99e-74 225 53 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium etli (strain CIAT 652)
B2GAT5 7.31e-74 225 51 1 203 3 upp Uracil phosphoribosyltransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q1MMV8 7.55e-74 224 53 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B8E009 7.55e-74 224 51 0 206 3 upp Uracil phosphoribosyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
P67397 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain MW2)
A8YY79 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G7J8 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain MSSA476)
Q6GEW3 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain MRSA252)
P67396 7.72e-74 224 51 0 207 1 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain N315)
P67395 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIV6 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain Newman)
Q5HE88 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain COL)
Q2YUJ2 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUQ7 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain JH9)
Q2FWE6 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF16 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain USA300)
A6U3J7 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain JH1)
A7X4V6 7.72e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6HAX0 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630T4 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain ZK / E33L)
Q814V3 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B9IRU7 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain Q1)
B7HY75 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain AH187)
B7HFL2 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain B4264)
C1F0N8 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain 03BB102)
B7IQW8 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain G9842)
Q72XD8 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JGP0 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus cereus (strain AH820)
Q81JY5 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus anthracis
C3LFI9 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1G4 8.51e-74 224 50 0 207 3 upp Uracil phosphoribosyltransferase Bacillus anthracis (strain A0248)
A8FIC0 8.8e-74 224 51 0 207 3 upp Uracil phosphoribosyltransferase Bacillus pumilus (strain SAFR-032)
A9KIB0 1.16e-73 224 52 0 207 3 upp Uracil phosphoribosyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A3DIL9 1.73e-73 224 50 0 207 3 upp Uracil phosphoribosyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q042K8 1.81e-73 224 51 0 207 3 upp Uracil phosphoribosyltransferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B5YDB8 2.16e-73 223 50 0 206 3 upp Uracil phosphoribosyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q8UJ06 2.2e-73 223 52 0 206 3 upp Uracil phosphoribosyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4L7Z3 2.43e-73 223 51 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q92T49 3.45e-73 223 53 0 206 3 upp Uracil phosphoribosyltransferase Rhizobium meliloti (strain 1021)
C3MBH2 4.06e-73 223 52 0 206 3 upp Uracil phosphoribosyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q576P9 4.06e-73 223 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella abortus biovar 1 (strain 9-941)
B2SC51 4.06e-73 223 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella abortus (strain S19)
A5VVW9 4.38e-73 223 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q49Z59 6.42e-73 222 53 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B9DMF2 6.93e-73 222 52 0 207 3 upp Uracil phosphoribosyltransferase Staphylococcus carnosus (strain TM300)
A7Z9Q8 6.93e-73 222 52 0 207 3 upp Uracil phosphoribosyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B2A3H5 7.16e-73 222 51 0 203 3 upp Uracil phosphoribosyltransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B1YEG7 1.01e-72 222 51 0 207 3 upp Uracil phosphoribosyltransferase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8YDE5 1.18e-72 221 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMK4 1.18e-72 221 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella melitensis biotype 2 (strain ATCC 23457)
Q9RU32 1.96e-72 221 51 2 211 3 upp Uracil phosphoribosyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A6WYH9 2.07e-72 221 51 0 208 3 upp Uracil phosphoribosyltransferase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8FUZ2 2.38e-72 221 50 0 208 3 upp Uracil phosphoribosyltransferase Brucella suis biovar 1 (strain 1330)
A9WW75 2.38e-72 221 50 0 208 3 upp Uracil phosphoribosyltransferase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9MCZ3 2.38e-72 221 50 0 208 3 upp Uracil phosphoribosyltransferase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A9NEQ2 2.81e-72 221 51 1 207 3 upp Uracil phosphoribosyltransferase Acholeplasma laidlawii (strain PG-8A)
Q8RG35 5.29e-72 220 50 1 208 3 upp Uracil phosphoribosyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A6UET4 5.9e-72 220 52 0 206 3 upp Uracil phosphoribosyltransferase Sinorhizobium medicae (strain WSM419)
B8I567 8.01e-72 219 50 0 201 3 upp Uracil phosphoribosyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B0T2R0 9.74e-72 219 51 0 203 3 upp Uracil phosphoribosyltransferase Caulobacter sp. (strain K31)
B8GYP3 1.1e-71 219 52 0 207 3 upp Uracil phosphoribosyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A627 1.1e-71 219 52 0 207 3 upp Uracil phosphoribosyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8EM74 1.29e-71 219 50 0 201 3 upp Uracil phosphoribosyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A1VN11 8.02e-71 217 50 0 203 3 upp Uracil phosphoribosyltransferase Polaromonas naphthalenivorans (strain CJ2)
A7NRA6 1.9e-70 216 50 1 206 3 upp Uracil phosphoribosyltransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B0TI63 3e-70 216 49 0 207 3 upp Uracil phosphoribosyltransferase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B9MJ16 3.5e-70 215 51 0 203 3 upp Uracil phosphoribosyltransferase Acidovorax ebreus (strain TPSY)
C4KYT2 3.62e-70 215 51 0 207 3 upp Uracil phosphoribosyltransferase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A9BWD4 3.82e-70 215 50 0 203 3 upp Uracil phosphoribosyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
A1W748 3.82e-70 215 51 0 203 3 upp Uracil phosphoribosyltransferase Acidovorax sp. (strain JS42)
C5CLM9 2.1e-68 211 49 0 203 3 upp Uracil phosphoribosyltransferase Variovorax paradoxus (strain S110)
Q8XXC7 2.11e-68 211 51 3 205 3 upp Uracil phosphoribosyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A5UQV0 5.19e-68 210 49 1 206 3 upp Uracil phosphoribosyltransferase Roseiflexus sp. (strain RS-1)
C1ARF7 5.79e-68 210 49 2 206 3 upp Uracil phosphoribosyltransferase Rhodococcus opacus (strain B4)
Q0SK44 7.94e-68 209 48 2 206 3 upp Uracil phosphoribosyltransferase Rhodococcus jostii (strain RHA1)
Q5WUK0 8.45e-68 209 50 0 203 3 upp Uracil phosphoribosyltransferase Legionella pneumophila (strain Lens)
Q5X340 8.45e-68 209 50 0 203 3 upp Uracil phosphoribosyltransferase Legionella pneumophila (strain Paris)
A1WQN5 8.96e-68 209 49 0 203 3 upp Uracil phosphoribosyltransferase Verminephrobacter eiseniae (strain EF01-2)
B2JE33 1.73e-67 209 50 3 205 3 upp Uracil phosphoribosyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q98GV3 2.19e-67 208 51 0 206 3 upp Uracil phosphoribosyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5ZTB9 2.23e-67 208 49 0 203 3 upp Uracil phosphoribosyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IE48 2.23e-67 208 49 0 203 3 upp Uracil phosphoribosyltransferase Legionella pneumophila (strain Corby)
Q2ST42 3.55e-67 207 51 1 208 3 upp Uracil phosphoribosyltransferase Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
B2U8Z0 9.4e-67 207 50 3 205 3 upp Uracil phosphoribosyltransferase Ralstonia pickettii (strain 12J)
B5ZAU8 1.12e-66 206 50 3 207 3 upp Uracil phosphoribosyltransferase Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q9PR28 1.37e-65 204 48 0 203 3 upp Uracil phosphoribosyltransferase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIA5 1.37e-65 204 48 0 203 3 upp Uracil phosphoribosyltransferase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
B2T2A6 2.3e-65 203 49 3 205 3 upp Uracil phosphoribosyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q142L5 2.86e-65 203 49 3 205 3 upp Uracil phosphoribosyltransferase Paraburkholderia xenovorans (strain LB400)
B1JW40 5.43e-65 202 49 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia orbicola (strain MC0-3)
B1YU48 5.43e-65 202 49 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia ambifaria (strain MC40-6)
Q9WZI0 6.37e-65 202 48 0 207 1 upp Uracil phosphoribosyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0BD86 7.46e-65 202 49 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q6MS86 9.99e-65 201 50 1 208 3 upp Uracil phosphoribosyltransferase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
B4E5R5 1.4e-64 201 49 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B9KAQ6 1.56e-64 201 47 0 207 3 upp Uracil phosphoribosyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q1DG16 1.81e-64 201 48 0 203 3 upp Uracil phosphoribosyltransferase Myxococcus xanthus (strain DK1622)
Q39EA2 2.19e-64 201 49 3 203 3 upp Uracil phosphoribosyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A4JGH4 2.85e-64 201 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9AJK1 3.78e-64 200 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
B1L7Y5 3.94e-64 200 46 0 207 3 upp Uracil phosphoribosyltransferase Thermotoga sp. (strain RQ2)
A5IJ64 3.94e-64 200 46 0 207 3 upp Uracil phosphoribosyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q2SZS9 9.98e-64 199 49 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63VS8 2.58e-63 198 48 3 205 1 upp Uracil phosphoribosyltransferase Burkholderia pseudomallei (strain K96243)
Q3JUF6 2.58e-63 198 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia pseudomallei (strain 1710b)
A3NT50 2.58e-63 198 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia pseudomallei (strain 1106a)
A1V2G4 2.58e-63 198 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia mallei (strain SAVP1)
Q62IJ1 2.58e-63 198 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4B1 2.58e-63 198 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia mallei (strain NCTC 10229)
A3MI49 2.58e-63 198 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia mallei (strain NCTC 10247)
A3N7G1 3.86e-63 197 48 3 205 3 upp Uracil phosphoribosyltransferase Burkholderia pseudomallei (strain 668)
A7HJR3 1.41e-62 196 47 0 203 3 upp Uracil phosphoribosyltransferase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q8EUA1 3.23e-62 195 47 1 201 3 upp Uracil phosphoribosyltransferase Malacoplasma penetrans (strain HF-2)
Q6F210 4.02e-62 195 49 1 208 3 upp Uracil phosphoribosyltransferase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A6LMU0 4.62e-62 195 46 0 208 3 upp Uracil phosphoribosyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B7IDR9 4.51e-61 192 45 0 208 3 upp Uracil phosphoribosyltransferase Thermosipho africanus (strain TCF52B)
Q9PJJ6 1.65e-60 194 44 0 205 3 upp Uracil phosphoribosyltransferase Chlamydia muridarum (strain MoPn / Nigg)
A7ZFB7 3.35e-60 190 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter concisus (strain 13826)
Q5HTC1 3.5e-60 190 43 1 202 3 upp Uracil phosphoribosyltransferase Campylobacter jejuni (strain RM1221)
A5CNC6 4.1e-60 190 45 1 209 3 upp Uracil phosphoribosyltransferase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
A1W0S0 5.35e-60 189 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FMZ1 5.35e-60 189 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q6KHA6 8.11e-60 189 45 0 203 3 upp Uracil phosphoribosyltransferase Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q9PN13 8.55e-60 189 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q89E48 1.41e-59 188 46 0 206 3 upp Uracil phosphoribosyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7NBH2 2.3e-59 188 44 2 211 3 upp Uracil phosphoribosyltransferase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q82FS4 4.56e-59 187 45 1 208 3 upp Uracil phosphoribosyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B6IW12 5.04e-59 187 47 2 205 3 upp Uracil phosphoribosyltransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
A7H0F9 2.76e-58 185 39 1 202 3 upp Uracil phosphoribosyltransferase Campylobacter curvus (strain 525.92)
A0RR59 5.18e-58 184 43 2 204 3 upp Uracil phosphoribosyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
P43049 2.51e-57 182 43 2 205 3 upp Uracil phosphoribosyltransferase Metamycoplasma hominis
Q6AHB4 6.26e-57 182 44 1 209 3 upp Uracil phosphoribosyltransferase Leifsonia xyli subsp. xyli (strain CTCB07)
A0JSM6 9.66e-57 181 45 1 208 3 upp Uracil phosphoribosyltransferase Arthrobacter sp. (strain FB24)
C5BXA3 1.03e-56 181 43 1 209 3 upp Uracil phosphoribosyltransferase Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
B3PM96 1.64e-56 181 43 0 206 3 upp Uracil phosphoribosyltransferase Metamycoplasma arthritidis (strain 158L3-1)
B1VNY5 1.98e-56 181 44 1 209 3 upp Uracil phosphoribosyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q9AK76 4.39e-56 179 44 1 208 3 upp Uracil phosphoribosyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B2HDV9 6.19e-56 179 44 1 208 3 upp Uracil phosphoribosyltransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q2S320 3.87e-55 177 44 2 211 3 upp Uracil phosphoribosyltransferase Salinibacter ruber (strain DSM 13855 / M31)
Q6A5S3 6.01e-55 177 44 1 210 3 upp Uracil phosphoribosyltransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
P9WFF3 1.05e-54 176 44 2 212 1 upp Uracil phosphoribosyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFF2 1.05e-54 176 44 2 212 3 upp Uracil phosphoribosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U7Y3 1.05e-54 176 44 2 212 3 upp Uracil phosphoribosyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KNZ5 1.05e-54 176 44 2 212 3 upp Uracil phosphoribosyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A659 1.05e-54 176 44 2 212 3 upp Uracil phosphoribosyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B8HCL2 2.13e-54 175 43 1 208 3 upp Uracil phosphoribosyltransferase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q8FRQ5 3.84e-54 175 43 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P58998 7.13e-54 174 43 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QC29 7.13e-54 174 43 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium glutamicum (strain R)
B2GFU4 9.88e-54 174 43 1 208 3 upp Uracil phosphoribosyltransferase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
A1R2Y2 1.7e-53 173 43 3 217 3 upp Uracil phosphoribosyltransferase Paenarthrobacter aurescens (strain TC1)
Q5MZF4 3.05e-53 172 42 4 212 3 upp Uracil phosphoribosyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31MH4 3.05e-53 172 42 4 212 3 upp Uracil phosphoribosyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A6W572 4.38e-53 172 42 1 209 3 upp Uracil phosphoribosyltransferase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A1SDD5 7.27e-53 171 42 1 210 3 upp Uracil phosphoribosyltransferase Nocardioides sp. (strain ATCC BAA-499 / JS614)
C4LKC1 5.38e-52 169 42 3 213 3 upp Uracil phosphoribosyltransferase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
C3PLD0 6.49e-52 169 42 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q4JTK4 8.68e-52 169 41 2 209 3 upp Uracil phosphoribosyltransferase Corynebacterium jeikeium (strain K411)
Q73UD7 1.18e-51 170 41 2 210 3 upp Uracil phosphoribosyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q6NIX4 1.23e-51 168 40 1 208 3 upp Uracil phosphoribosyltransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B1VF60 1.11e-50 166 40 2 209 3 upp Uracil phosphoribosyltransferase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
O67914 2.33e-50 165 37 1 205 1 upp Uracil phosphoribosyltransferase Aquifex aeolicus (strain VF5)
P75081 2.42e-50 165 39 1 204 3 upp Uracil phosphoribosyltransferase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A9WLN5 2.5e-50 165 41 1 208 3 upp Uracil phosphoribosyltransferase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
P47276 8.46e-50 163 37 1 204 3 upp Uracil phosphoribosyltransferase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q98QP6 8.6e-50 163 41 2 209 3 upp Uracil phosphoribosyltransferase Mycoplasmopsis pulmonis (strain UAB CTIP)
Q5Z187 1.22e-48 160 40 1 208 3 upp Uracil phosphoribosyltransferase Nocardia farcinica (strain IFM 10152)
B1MFZ1 2.06e-48 160 38 3 218 3 upp Uracil phosphoribosyltransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A5IYF5 3.68e-48 159 42 1 202 3 upp Uracil phosphoribosyltransferase Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
B3DPH5 3.57e-47 157 37 2 210 3 upp Uracil phosphoribosyltransferase Bifidobacterium longum (strain DJO10A)
A0ZZM2 3.77e-47 157 39 3 210 3 upp Uracil phosphoribosyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
B8DVI9 1.29e-46 155 37 2 210 3 upp Uracil phosphoribosyltransferase Bifidobacterium animalis subsp. lactis (strain AD011)
P72753 6.68e-46 154 40 6 222 3 upp Uracil phosphoribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B7GNR5 8.03e-46 154 37 3 210 3 upp Uracil phosphoribosyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8YVB5 1.37e-45 153 41 6 215 3 upp Uracil phosphoribosyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9M336 3.82e-44 152 40 4 213 1 UPP Uracil phosphoribosyltransferase, chloroplastic Arabidopsis thaliana
P93394 2.72e-43 147 38 4 212 2 UPP Uracil phosphoribosyltransferase Nicotiana tabacum
B6YTB2 2.01e-35 127 34 4 206 3 upp Uracil phosphoribosyltransferase Thermococcus onnurineus (strain NA1)
O13867 4.3e-35 126 46 1 141 3 SPAC1B3.01c Uracil phosphoribosyltransferase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5JGQ6 1.02e-34 125 35 3 201 3 upp Uracil phosphoribosyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9US43 1.72e-34 124 30 3 200 3 urg2 Putative uracil phosphoribosyltransferase urg2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6USD4 6.19e-32 118 34 5 209 3 upp Uracil phosphoribosyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q8U1G7 4.67e-31 116 32 3 201 3 upp Uracil phosphoribosyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A4WMQ7 2.19e-30 114 33 3 211 3 upp Uracil phosphoribosyltransferase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q5UZD3 4.76e-30 113 33 5 213 3 upp Uracil phosphoribosyltransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
C3N7P3 1.5e-29 112 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NFT0 1.5e-29 112 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MY92 1.5e-29 112 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MRJ6 1.5e-29 112 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3MZM1 1.5e-29 112 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain M.16.27)
C4KIV1 1.74e-29 112 31 5 219 3 upp Uracil phosphoribosyltransferase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
Q9V0K1 3.04e-29 111 32 4 206 3 upp Uracil phosphoribosyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q3ISU0 5.45e-29 110 34 6 212 3 upp Uracil phosphoribosyltransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q26998 6.2e-29 111 33 3 202 1 uprt Uracil phosphoribosyltransferase Toxoplasma gondii
A1RV13 6.8e-29 110 31 3 211 3 upp Uracil phosphoribosyltransferase Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q6LZE9 6.81e-29 110 31 4 210 3 upp Uracil phosphoribosyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A6VJY4 7.82e-29 110 32 3 205 3 upp Uracil phosphoribosyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q8ZWV9 9.57e-29 109 31 3 211 3 upp Uracil phosphoribosyltransferase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
C5A6P6 1.4e-28 109 30 5 212 3 upp Uracil phosphoribosyltransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q980Q4 1.57e-28 109 31 5 219 1 upp Uracil phosphoribosyltransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
C6A3U9 1.69e-28 109 32 4 206 3 upp Uracil phosphoribosyltransferase Thermococcus sibiricus (strain DSM 12597 / MM 739)
A9A7A5 4.3e-28 108 32 4 210 3 upp Uracil phosphoribosyltransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A4FYB9 5.98e-28 108 31 4 210 3 upp Uracil phosphoribosyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
B9LUM1 7.01e-28 108 33 5 213 3 upp Uracil phosphoribosyltransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q55GQ6 7.31e-28 107 34 2 208 3 uprt Uracil phosphoribosyltransferase Dictyostelium discoideum
P18562 9.96e-28 107 33 4 206 1 FUR1 Uracil phosphoribosyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HN05 1.02e-27 107 33 4 215 3 upp Uracil phosphoribosyltransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R7K0 1.02e-27 107 33 4 215 3 upp Uracil phosphoribosyltransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q4JAV0 1.27e-27 107 29 4 220 3 upp Uracil phosphoribosyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q18DK8 1.45e-27 107 34 5 214 3 upp Uracil phosphoribosyltransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
A4YCQ1 1.88e-27 106 31 3 216 3 upp Uracil phosphoribosyltransferase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q975Z7 1.99e-27 106 28 5 223 3 upp Uracil phosphoribosyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A5H0J4 2.27e-24 98 37 1 138 3 FUR1 Uracil phosphoribosyltransferase Lachancea kluyveri
O27186 4.06e-24 97 28 4 204 3 upp Uracil phosphoribosyltransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9YEN3 1.18e-23 96 29 2 210 3 upp Uracil phosphoribosyltransferase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
P0C939 2.62e-23 95 31 7 216 3 upp Uracil phosphoribosyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_08415
Feature type CDS
Gene upp
Product uracil phosphoribosyltransferase
Location 156491 - 157117 (strand: 1)
Length 627 (nucleotides) / 208 (amino acids)

Contig

Accession ZDB_217
Length 250991 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2196
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF14681 Uracil phosphoribosyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0035 Nucleotide transport and metabolism (F) F Uracil phosphoribosyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00761 uracil phosphoribosyltransferase [EC:2.4.2.9] Pyrimidine metabolism
Metabolic pathways
Nucleotide metabolism
-

Protein Sequence

MKVVEVKHPLVKHKLGLMRDHDISTKRFRELASEVGSLLTYEATSDLETEKVTIDGWCGPVEIEQIKGKKITVVPILRAGIGMMNGVLESIPSARISVVGVYRDEETLEPVPYFQKLASNIEERMALVVDPMLATGGSMIATIDLLKKAGCTAIKILVLVAAPEGLKALEKAHPDVELYTASIDDHLNEHGYIVPGLGDAGDKIFGTK

Flanking regions ( +/- flanking 50bp)

ATAATCTCGCGATTTTTTTGTCCGCCAGGGCTTACACAGTAGGAGAACCCATGAAAGTCGTCGAGGTAAAACACCCGCTCGTTAAACACAAACTTGGCCTGATGCGAGATCATGATATAAGCACAAAACGCTTTCGTGAACTGGCCTCAGAAGTCGGTAGCCTGCTGACCTATGAAGCAACTTCAGACTTAGAAACTGAGAAAGTGACAATTGACGGCTGGTGTGGTCCGGTCGAAATTGAACAAATCAAGGGTAAAAAGATTACCGTTGTGCCAATCCTGCGTGCGGGTATCGGTATGATGAACGGTGTGCTGGAAAGCATCCCGAGTGCCCGTATCAGTGTTGTCGGTGTTTACCGTGATGAAGAAACACTGGAGCCGGTACCGTACTTCCAGAAATTAGCCTCTAATATTGAAGAGCGTATGGCGCTGGTGGTTGACCCGATGCTGGCAACCGGCGGTTCAATGATCGCTACCATCGATCTGCTGAAAAAAGCAGGCTGCACCGCGATTAAAATCCTTGTGCTGGTTGCAGCGCCGGAAGGTCTGAAAGCGCTGGAAAAAGCCCACCCGGATGTTGAGCTGTATACCGCATCCATCGACGATCACCTTAACGAACACGGTTACATTGTGCCGGGCCTGGGTGATGCGGGCGATAAGATATTTGGTACGAAATAAGTTAATGAGCCGACTTGATAGTCGGCTTTTTTTTGGCATATCCCTGAGTA