Homologs in group_1644

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10870 FBDBKF_10870 100.0 Morganella morganii S1 potE putrescine-ornithine antiporter
NLDBIP_05675 NLDBIP_05675 100.0 Morganella morganii S4 potE putrescine-ornithine antiporter
LHKJJB_02555 LHKJJB_02555 100.0 Morganella morganii S3 potE putrescine-ornithine antiporter
HKOGLL_15935 HKOGLL_15935 100.0 Morganella morganii S5 potE putrescine-ornithine antiporter
F4V73_RS11530 F4V73_RS11530 95.5 Morganella psychrotolerans potE putrescine-ornithine antiporter
PMI_RS01475 PMI_RS01475 93.7 Proteus mirabilis HI4320 potE putrescine-ornithine antiporter

Distribution of the homologs in the orthogroup group_1644

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1644

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AAF1 0.0 741 82 0 438 1 potE Putrescine transporter PotE Escherichia coli (strain K12)
P0AAF2 0.0 741 82 0 438 3 potE Putrescine transporter PotE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P44768 0.0 664 73 0 435 3 potE Putrescine transporter PotE Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P60064 1.27e-82 264 35 2 412 3 adiC Arginine/agmatine antiporter Shigella flexneri
P60061 1.27e-82 264 35 2 412 1 adiC Arginine/agmatine antiporter Escherichia coli (strain K12)
P60062 1.27e-82 264 35 2 412 3 adiC Arginine/agmatine antiporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P60063 1.27e-82 264 35 2 412 1 adiC Arginine/agmatine antiporter Escherichia coli O157:H7
Q8ZGS9 2.46e-82 263 34 1 426 3 adiC Arginine/agmatine antiporter Yersinia pestis
P60066 1.3e-81 261 34 2 412 1 adiC Arginine/agmatine antiporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60065 1.3e-81 261 34 2 412 3 adiC Arginine/agmatine antiporter Salmonella typhi
P0AAE8 3.93e-50 179 31 6 408 1 cadB Cadaverine/lysine antiporter Escherichia coli (strain K12)
P0AAE9 3.93e-50 179 31 6 408 3 cadB Cadaverine/lysine antiporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF0 3.93e-50 179 31 6 408 3 cadB Cadaverine/lysine antiporter Escherichia coli O157:H7
O32204 3.67e-28 119 27 18 465 3 yvsH Putative arginine/ornithine antiporter Bacillus subtilis (strain 168)
P0AAE7 1.29e-20 97 26 12 417 3 ydgI Putative arginine/ornithine antiporter Shigella flexneri
P0AAE5 1.29e-20 97 26 12 417 1 ydgI Putative arginine/ornithine antiporter Escherichia coli (strain K12)
P0AAE6 1.29e-20 97 26 12 417 3 ydgI Putative arginine/ornithine antiporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q46170 1.54e-20 97 24 11 414 3 arcD Arginine/ornithine antiporter Clostridium perfringens (strain 13 / Type A)
Q5L5E6 3.46e-16 84 23 9 424 3 aaxC Arginine/agmatine antiporter Chlamydia abortus (strain DSM 27085 / S26/3)
A2RHI9 3.63e-15 80 22 10 448 1 bcaP Branched-chain amino acid permease BcaP Lactococcus lactis subsp. cremoris (strain MG1363)
O34739 5.45e-12 70 25 14 397 1 steT Serine/threonine exchanger SteT Bacillus subtilis (strain 168)
Q822F2 5.46e-12 71 22 10 440 3 aaxC Arginine/agmatine antiporter Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
O53092 7.32e-12 70 23 11 433 3 arcD Arginine/ornithine antiporter Latilactobacillus sakei
Q9Z6M8 7.36e-12 70 23 10 424 1 aaxC Arginine/agmatine antiporter Chlamydia pneumoniae
Q45577 2.21e-11 69 22 10 428 1 aimA Glutamate/serine transporter AimA Bacillus subtilis (strain 168)
A2RNI5 3.05e-11 68 21 13 468 1 arcD1 Arginine/ornithine antiporter ArcD1 Lactococcus lactis subsp. cremoris (strain MG1363)
P18275 9.58e-11 67 22 12 428 1 arcD Arginine/ornithine antiporter Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37034 1.07e-10 67 22 12 403 3 lpg1691 Uncharacterized transporter lpg1691 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P0C217 1.6e-10 66 22 15 471 3 CPE0389 Putative amino-acid transporter CPE0389 Clostridium perfringens (strain 13 / Type A)
Q0TU56 1.6e-10 66 22 15 471 3 CPF_0377 Putative amino-acid transporter CPF_0377 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8W4K3 8.14e-10 64 23 5 207 1 CAT4 Cationic amino acid transporter 4, vacuolar Arabidopsis thaliana
Q9WTR6 4.81e-09 62 23 15 431 1 Slc7a11 Cystine/glutamate transporter Mus musculus
Q255I1 2.49e-08 59 20 13 429 3 aaxC Arginine/agmatine antiporter Chlamydia felis (strain Fe/C-56)
Q9UPY5 5.89e-08 58 24 15 393 1 SLC7A11 Cystine/glutamate transporter Homo sapiens
Q5RAG7 7.2e-08 58 24 15 393 2 SLC7A11 Cystine/glutamate transporter Pongo abelii
P35865 1.24e-07 57 21 16 465 3 lysI L-lysine transport protein Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8BGK6 1.39e-07 57 22 8 340 1 Slc7a6 Y+L amino acid transporter 2 Mus musculus
Q797A7 1.87e-07 57 22 7 345 3 mtrA Methylthioribose transporter Bacillus subtilis (strain 168)
D3ZMM8 1.95e-07 57 22 8 340 1 Slc7a6 Y+L amino acid transporter 2 Rattus norvegicus
Q92536 3.75e-07 56 23 9 341 1 SLC7A6 Y+L amino acid transporter 2 Homo sapiens
Q9CG19 4.36e-07 55 21 15 369 3 gadC Glutamate/gamma-aminobutyrate antiporter Lactococcus lactis subsp. lactis (strain IL1403)
O30417 7.38e-07 55 21 15 369 2 gadC Glutamate/gamma-aminobutyrate antiporter Lactococcus lactis subsp. cremoris (strain MG1363)
Q8FHG6 9.2e-07 54 22 10 289 3 gadC Glutamate/gamma-aminobutyrate antiporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63236 9.96e-07 54 22 10 289 3 gadC Glutamate/gamma-aminobutyrate antiporter Shigella flexneri
P63235 9.96e-07 54 22 10 289 1 gadC Glutamate/gamma-aminobutyrate antiporter Escherichia coli (strain K12)
P58229 1.01e-06 54 22 10 289 3 gadC Glutamate/gamma-aminobutyrate antiporter Escherichia coli O157:H7
B0BC08 1.08e-06 54 20 14 473 3 aaxC Arginine/agmatine antiporter Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7U3 1.08e-06 54 20 14 473 3 aaxC Arginine/agmatine antiporter Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
O34560 1.16e-06 54 23 4 251 3 yecA Uncharacterized amino acid permease YecA Bacillus subtilis (strain 168)
Q9PK20 1.77e-06 53 21 14 470 3 aaxC Arginine/agmatine antiporter Chlamydia muridarum (strain MoPn / Nigg)
Q9ASS7 2.17e-06 53 26 2 129 1 CAT2 Cationic amino acid transporter 2, vacuolar Arabidopsis thaliana
Q9LZ20 6.04e-06 52 25 6 213 2 CAT6 Cationic amino acid transporter 6, chloroplastic Arabidopsis thaliana
Q9C5D6 1.02e-05 51 26 3 145 2 CAT9 Cationic amino acid transporter 9, chloroplastic Arabidopsis thaliana
O43246 1.2e-05 51 24 9 352 1 SLC7A4 Cationic amino acid transporter 4 Homo sapiens
Q8BLQ7 1.41e-05 51 24 8 351 1 Slc7a4 Cationic amino acid transporter 4 Mus musculus
A0A0H2VDI7 1.84e-05 50 20 3 197 1 cycA D-serine/D-alanine/glycine transporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P9WQM5 2.22e-05 50 20 10 407 1 Rv1979c Uncharacterized transporter Rv1979c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM4 2.22e-05 50 20 10 407 3 MT2031 Uncharacterized transporter MT2031 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q28I80 2.67e-05 50 21 9 336 2 slc7a6 Y+L amino acid transporter 2 Xenopus tropicalis
O07576 2.87e-05 50 21 7 269 1 bcaP Branched-chain amino acid permease BcaP Bacillus subtilis (strain 168)
Q7TZ67 4.13e-05 49 20 10 407 3 BQ2027_MB2001C Uncharacterized transporter Mb2001c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B5BP45 4.14e-05 49 27 3 154 3 SPBC460.01c Uncharacterized amino-acid permease C460.01c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O84379 4.84e-05 49 20 15 474 3 aaxC Arginine/agmatine antiporter Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KLY0 4.84e-05 49 20 15 474 3 aaxC Arginine/agmatine antiporter Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
P15993 4.85e-05 49 21 17 404 1 aroP Aromatic amino acid transport protein AroP Escherichia coli (strain K12)
P59737 5.24e-05 49 21 17 404 3 aroP Aromatic amino acid transport protein AroP Shigella flexneri
P37460 5.28e-05 49 21 3 193 3 proY Proline-specific permease ProY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AAE2 5.38e-05 49 21 3 193 1 proY Proline-specific permease ProY Escherichia coli (strain K12)
P0AAE3 5.38e-05 49 21 3 193 3 proY Proline-specific permease ProY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAE4 5.38e-05 49 21 3 193 3 proY Proline-specific permease ProY Escherichia coli O157:H7
P0AAE0 5.67e-05 48 20 3 197 1 cycA D-serine/D-alanine/glycine transporter Escherichia coli (strain K12)
P0AAE1 5.67e-05 48 20 3 197 3 cycA D-serine/D-alanine/glycine transporter Escherichia coli O157:H7
P18581 5.74e-05 49 21 2 179 1 Slc7a2 Cationic amino acid transporter 2 Mus musculus
A8I499 5.79e-05 49 22 2 179 2 SLC7A2 Cationic amino acid transporter 2 Sus scrofa
A1L3M3 7.01e-05 48 21 9 341 2 slc7a6 Y+L amino acid transporter 2 Xenopus laevis
Q22397 8.68e-05 48 22 12 362 1 aat-6 Amino acid transporter protein 6 Caenorhabditis elegans
O34618 0.000109 48 24 4 157 3 ytnA Uncharacterized amino acid permease YtnA Bacillus subtilis (strain 168)
Q9CEY5 0.000113 48 25 6 204 3 aguD Probable agmatine/putrescine antiporter AguD Lactococcus lactis subsp. lactis (strain IL1403)
Q9URZ4 0.000113 48 23 9 305 1 cat1 Cationic amino acid transporter 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B5D5N9 0.000137 48 21 2 179 1 Slc7a2 Cationic amino acid transporter 2 Rattus norvegicus
P39277 0.000141 47 23 11 301 1 yjeH L-methionine/branched-chain amino acid exporter YjeH Escherichia coli (strain K12)
Q9UM01 0.000166 47 26 17 335 1 SLC7A7 Y+L amino acid transporter 1 Homo sapiens
O32257 0.000167 47 20 1 136 2 yvbW Uncharacterized amino acid permease YvbW Bacillus subtilis (strain 168)
Q8X968 0.000175 47 21 17 404 3 aroP Aromatic amino acid transport protein AroP Escherichia coli O157:H7
Q59I64 0.000189 47 22 10 336 2 slc7a6 Y+L amino acid transporter 2 Danio rerio
A2RNI1 0.000208 47 21 15 431 1 arcD2 Arginine/ornithine antiporter ArcD2 Lactococcus lactis subsp. cremoris (strain MG1363)
Q5PR34 0.000306 47 20 2 190 2 slc7a2 Cationic amino acid transporter 2 Danio rerio
Q8FL49 0.000309 46 21 17 404 3 aroP Aromatic amino acid transport protein AroP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8GYB4 0.0004 46 23 2 132 2 CAT3 Cationic amino acid transporter 3, mitochondrial Arabidopsis thaliana
Q6DCE8 0.000424 46 23 7 201 2 slc7a2 Cationic amino acid transporter 2 Xenopus laevis
Q9P5N4 0.000451 46 22 10 348 3 SPBC359.01 Uncharacterized amino-acid permease C359.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q876K6 0.000526 46 20 12 388 3 AGP1 General amino acid permease AGP1 Saccharomyces uvarum (strain ATCC 76518 / CBS 7001 / CLIB 283 / NBRC 10550 / MCYC 623 / NCYC 2669 / NRRL Y-11845)
A0A1D8PMB1 0.000579 46 18 8 422 2 GAP5 Amino-acid permease GAP5 Candida albicans (strain SC5314 / ATCC MYA-2876)
P30825 0.000755 45 21 3 188 1 SLC7A1 High affinity cationic amino acid transporter 1 Homo sapiens
Q9C0V0 0.000801 45 23 4 199 3 SPCPB1C11.02 Probable amino-acid permease PB1C11.02 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HDV2 0.000802 45 23 3 176 3 SPBPB2B2.01 Uncharacterized amino-acid permease PB2B2.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P45539 0.001 45 32 2 114 2 frlA Probable fructoselysine/psicoselysine transporter FrlA Escherichia coli (strain K12)
P40901 0.001 45 22 3 209 2 isp5 Sexual differentiation process putative amino-acid permease isp5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5RAE3 0.001 45 21 12 371 2 SLC7A8 Large neutral amino acids transporter small subunit 2 Pongo abelii
Q9UHI5 0.001 45 21 12 371 1 SLC7A8 Large neutral amino acids transporter small subunit 2 Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_05355
Feature type CDS
Gene potE
Product putrescine-ornithine antiporter
Location 55206 - 56567 (strand: -1)
Length 1362 (nucleotides) / 453 (amino acids)

Contig

Accession ZDB_215
Length 284267 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1644
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13520 Amino acid permease

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0531 Amino acid transport and metabolism (E) E Serine transporter YbeC, amino acid:H+ symporter family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03756 putrescine:ornithine antiporter - -

Protein Sequence

MSVLRQPGRNMMSASKNKMSVLQLTILTAVNMMGSGIIMLPTKLAEVGTVSILSWLVTAVGSMALAYAFAKCGMYSRRSGGMGGYAEYAFGKSGNFMANYTYGVSLLIANVAIAISAVGYGAELMDAAMTPLGICIATIVVLWICTVANFGGARITGRISSVTVWGVIIPVVGISVIGWWWFSPELYVNSWNPHNFPLFEAVGSSIAMTLWAFLGMESACANSEAVDNPEKNVPIAVLGGTLGAAVIYIVSTNVIAGIVPNMDLANSTAPFGLAFSQMFTPGVGKVVMALMIMSCCGSLLGWQFTIAQVFKSSSDSGYFPKIFSAVTKADAPVKGMLVIVIIQSALSLMTISPSLNKQFNVLVNLAVVTNIIPYILSMAAMIILQKVANVDPKKARTGNVIAFIGAVYSFYALYSSGEDAVMWGALATFLGWTLYGFVSPRFEMKQNQDVMMK

Flanking regions ( +/- flanking 50bp)

GCTATGTAATTAAACACTGAGTTCGTTAATTCGTGCATGGCGGAGCGCGGATGAGCGTGCTCCGTCAGCCGGGGAGAAATATGATGAGTGCTTCAAAGAATAAAATGAGCGTATTACAGCTCACTATATTAACCGCAGTGAATATGATGGGATCCGGCATCATTATGCTGCCGACAAAACTGGCGGAAGTGGGGACGGTTTCTATTCTGTCATGGCTTGTGACCGCCGTCGGTTCTATGGCTCTGGCTTATGCATTTGCCAAGTGCGGTATGTACAGCCGCCGCAGCGGCGGGATGGGAGGTTACGCGGAATACGCATTCGGTAAATCCGGTAACTTTATGGCGAATTATACCTATGGTGTTTCTCTGCTGATTGCAAACGTTGCGATCGCGATTTCAGCCGTCGGTTATGGGGCTGAACTGATGGATGCGGCGATGACGCCGCTGGGTATCTGTATTGCCACAATTGTTGTGTTGTGGATTTGTACGGTGGCAAACTTCGGCGGTGCACGGATCACCGGACGGATCAGCAGTGTGACTGTCTGGGGGGTCATTATTCCGGTTGTCGGTATTTCGGTTATCGGCTGGTGGTGGTTCAGTCCTGAACTGTATGTTAATTCCTGGAACCCGCATAATTTTCCGCTTTTTGAGGCGGTCGGTTCCTCTATTGCGATGACATTATGGGCATTTTTAGGAATGGAGTCAGCCTGTGCTAACAGTGAGGCGGTTGATAATCCTGAGAAAAATGTGCCGATAGCAGTATTGGGCGGAACATTAGGCGCAGCGGTTATTTATATCGTATCAACAAACGTCATTGCCGGTATTGTACCGAATATGGATCTGGCAAACTCTACTGCACCGTTTGGCCTGGCATTCTCACAAATGTTTACGCCGGGTGTGGGTAAGGTTGTTATGGCGCTGATGATTATGTCTTGCTGCGGTTCATTGTTAGGCTGGCAGTTCACCATTGCGCAGGTATTTAAATCATCATCTGATTCCGGTTATTTCCCGAAAATCTTTTCTGCCGTTACCAAAGCGGATGCCCCGGTAAAAGGTATGCTGGTTATTGTTATTATTCAGTCTGCACTGTCGCTGATGACCATCAGCCCGTCACTGAATAAACAGTTCAATGTGCTGGTTAACCTGGCGGTTGTTACCAATATTATCCCTTATATCCTTTCCATGGCTGCCATGATTATTCTGCAGAAAGTCGCCAATGTGGATCCTAAGAAAGCACGGACAGGCAATGTGATTGCATTTATCGGTGCTGTTTATAGTTTCTATGCGCTGTATTCATCCGGTGAAGATGCTGTGATGTGGGGGGCGCTTGCCACCTTCCTCGGCTGGACACTGTATGGTTTTGTTTCCCCGCGGTTTGAAATGAAACAAAACCAGGACGTAATGATGAAATAACGAACACTCTCCGGTGGGTTCCTCCCGTGCAGTAACGGCGGGAGGATTTT