Homologs in group_2599

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02755 FBDBKF_02755 100.0 Morganella morganii S1 araJ putative arabinose efflux permease AraJ, MFS family
NLDBIP_00235 NLDBIP_00235 100.0 Morganella morganii S4 araJ putative arabinose efflux permease AraJ, MFS family
LHKJJB_01800 LHKJJB_01800 100.0 Morganella morganii S3 araJ putative arabinose efflux permease AraJ, MFS family
HKOGLL_01840 HKOGLL_01840 100.0 Morganella morganii S5 araJ putative arabinose efflux permease AraJ, MFS family
F4V73_RS05230 F4V73_RS05230 76.2 Morganella psychrotolerans - MFS transporter

Distribution of the homologs in the orthogroup group_2599

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2599

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P46105 2.46e-45 169 32 6 414 3 actII-2 Probable actinorhodin transporter Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P9WG88 4.25e-34 137 30 11 430 3 emrB Multidrug resistance protein B homolog Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WG89 1.63e-32 133 30 11 430 3 emrB Multidrug resistance protein B homolog Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG87 9.21e-32 131 27 6 433 3 Rv1250 Uncharacterized MFS-type transporter Rv1250 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG86 9.21e-32 131 27 6 433 3 MT1289 Uncharacterized MFS-type transporter MT1289 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WG90 5.77e-28 120 26 7 416 3 stp Multidrug resistance protein Stp Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WG91 1.03e-26 116 26 7 416 1 stp Multidrug resistance protein Stp Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P39886 2.94e-25 112 28 14 412 3 tcmA Tetracenomycin C resistance and export protein Streptomyces glaucescens
A6TBH6 7.23e-25 110 27 6 422 3 mdtD Putative multidrug resistance protein MdtD Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P76269 7.94e-25 110 25 9 431 3 yebQ Uncharacterized transporter YebQ Escherichia coli (strain K12)
P9WJW9 1.13e-24 110 26 12 486 2 jefA Drug efflux pump JefA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJW8 1.13e-24 110 26 12 486 3 jefA Drug efflux pump JefA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P44903 5.48e-24 107 24 6 419 3 hsrA Probable transport protein HsrA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B5XPB7 1.31e-23 106 27 6 419 3 mdtD Putative multidrug resistance protein MdtD Klebsiella pneumoniae (strain 342)
A4WCC3 2.57e-23 105 26 9 436 3 mdtD Putative multidrug resistance protein MdtD Enterobacter sp. (strain 638)
P31474 5.97e-23 104 24 8 442 1 hsrA Probable transport protein HsrA Escherichia coli (strain K12)
P11545 7.6e-23 104 31 7 316 3 mmr Methylenomycin A resistance protein Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A8AEE4 1.01e-22 103 27 3 312 3 mdtD Putative multidrug resistance protein MdtD Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P52600 1.61e-22 103 28 15 455 2 emrY Probable multidrug resistance protein EmrY Escherichia coli (strain K12)
C6DBD0 2.31e-22 102 29 3 308 3 mdtD Putative multidrug resistance protein MdtD Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D2A9 2.53e-22 102 28 4 314 3 mdtD Putative multidrug resistance protein MdtD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JKW8 3.36e-22 102 25 7 435 3 mdtD Putative multidrug resistance protein MdtD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P34698 3.41e-22 102 28 9 445 3 SACE_5813 Uncharacterized MFS-type transporter SACE_5813 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
P0A0J9 3.55e-22 102 25 11 417 1 qacA Antiseptic resistance protein Staphylococcus aureus
P0A0J8 3.55e-22 102 25 11 417 3 qacA Antiseptic resistance protein Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q00538 2.78e-21 99 29 5 319 3 mmr Methylenomycin A resistance protein Bacillus subtilis (strain 168)
O34502 4.63e-21 99 28 10 428 3 yvkA Uncharacterized MFS-type transporter YvkA Bacillus subtilis (strain 168)
A8GHR1 6.65e-21 98 28 3 306 3 mdtD Putative multidrug resistance protein MdtD Serratia proteamaculans (strain 568)
B1JSD2 1.82e-20 97 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TMR4 1.82e-20 97 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis (strain Pestoides F)
Q1CK62 1.82e-20 97 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZU7 1.82e-20 97 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis bv. Antiqua (strain Angola)
Q7CJL1 1.82e-20 97 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis
B2K9M2 1.82e-20 97 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5L8 1.82e-20 97 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis bv. Antiqua (strain Antiqua)
A7FG15 1.82e-20 97 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5FMU8 2.27e-20 97 27 4 318 3 mdtD Putative multidrug resistance protein MdtD Salmonella dublin (strain CT_02021853)
Q668C4 2.8e-20 96 26 4 309 3 mdtD Putative multidrug resistance protein MdtD Yersinia pseudotuberculosis serotype I (strain IP32953)
P42670 3.07e-20 96 31 13 429 3 pur8 Puromycin resistance protein pur8 Streptomyces alboniger
Q9RQ29 6.04e-20 95 27 11 422 1 farB Fatty acid resistance protein FarB Neisseria gonorrhoeae
Q8Z5F5 6.72e-20 95 27 4 318 3 mdtD Putative multidrug resistance protein MdtD Salmonella typhi
B5BF67 1.04e-19 95 27 4 318 3 mdtD Putative multidrug resistance protein MdtD Salmonella paratyphi A (strain AKU_12601)
Q5PDW9 1.04e-19 95 27 4 318 3 mdtD Putative multidrug resistance protein MdtD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SXW2 1.11e-19 95 27 4 318 3 mdtD Putative multidrug resistance protein MdtD Salmonella newport (strain SL254)
B5R0C2 1.11e-19 95 27 4 318 3 mdtD Putative multidrug resistance protein MdtD Salmonella enteritidis PT4 (strain P125109)
B5EXV9 1.11e-19 95 27 4 318 3 mdtD Putative multidrug resistance protein MdtD Salmonella agona (strain SL483)
B4TNI8 1.53e-19 94 26 3 311 3 mdtD Putative multidrug resistance protein MdtD Salmonella schwarzengrund (strain CVM19633)
A9N7L0 1.55e-19 94 26 3 311 3 mdtD Putative multidrug resistance protein MdtD Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T9U3 1.58e-19 94 26 3 311 3 mdtD Putative multidrug resistance protein MdtD Salmonella heidelberg (strain SL476)
Q8ZNQ0 1.66e-19 94 27 4 318 3 mdtD Putative multidrug resistance protein MdtD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P46104 2.08e-19 94 28 11 418 3 lmrA Lincomycin resistance protein Streptomyces lincolnensis
A7MHI9 1.33e-18 91 28 6 322 3 mdtD Putative multidrug resistance protein MdtD Cronobacter sakazakii (strain ATCC BAA-894)
B7LV41 1.42e-18 91 28 7 320 3 mdtD Putative multidrug resistance protein MdtD Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P54585 2.84e-18 90 25 12 430 3 yhcA Uncharacterized MFS-type transporter YhcA Bacillus subtilis (strain 168)
O32182 6.69e-18 89 30 4 216 3 yusP Uncharacterized MFS-type transporter YusP Bacillus subtilis (strain 168)
Q04733 1.27e-17 89 31 13 415 3 cmcT Cephamycin export protein CmcT Amycolatopsis lactamdurans
Q0T353 4.59e-17 87 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Shigella flexneri serotype 5b (strain 8401)
A7ZNQ0 8.88e-17 86 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83QZ0 1.07e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Shigella flexneri
B7NQA9 1.1e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L9V0 1.2e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli (strain 55989 / EAEC)
B1LNW4 1.22e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli (strain SMS-3-5 / SECEC)
B7M460 1.24e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O8 (strain IAI1)
B7UTB5 1.29e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B6HYS2 1.3e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli (strain SE11)
Q323D8 1.38e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Shigella boydii serotype 4 (strain Sb227)
B5YUD5 1.46e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7I3 1.46e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O157:H7
B2TYA6 1.51e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P36554 1.51e-16 85 27 6 319 1 mdtD Putative multidrug resistance protein MdtD Escherichia coli (strain K12)
B1IYZ7 1.51e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A1U9 1.51e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O9:H4 (strain HS)
B1X7H3 1.51e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli (strain K12 / DH10B)
C4ZSG5 1.51e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli (strain K12 / MC4100 / BW2952)
B7NCB3 1.55e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3Z0C7 1.73e-16 85 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Shigella sonnei (strain Ss046)
Q8Y9K8 2.74e-16 84 25 10 414 3 lmrB Lincomycin resistance protein LmrB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P9WJY5 4.28e-16 84 27 12 405 1 efpA Uncharacterized MFS-type transporter EfpA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJY4 4.28e-16 84 27 12 405 3 efpA Uncharacterized MFS-type transporter EfpA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q92EE1 4.67e-16 84 25 10 414 3 lmrB Lincomycin resistance protein LmrB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0TG13 4.88e-16 84 27 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O31563 6.36e-16 83 22 11 449 3 yfiU Uncharacterized MFS-type transporter YfiU Bacillus subtilis (strain 168)
B7MWZ0 1.06e-15 82 26 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O81 (strain ED1a)
A1ACT2 1.23e-15 82 26 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O1:K1 / APEC
Q1R9Z4 1.26e-15 82 26 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli (strain UTI89 / UPEC)
B7ME89 1.26e-15 82 26 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FG02 1.39e-15 82 26 6 319 3 mdtD Putative multidrug resistance protein MdtD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P96712 1.57e-15 82 25 8 388 1 bmr3 Multidrug resistance protein 3 Bacillus subtilis (strain 168)
P37594 4.74e-15 80 31 11 319 3 smvA Methyl viologen resistance protein SmvA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZXQ3 4.74e-15 80 31 11 319 1 smvA Methyl viologen resistance protein SmvA Salmonella typhimurium (strain 14028s / SGSC 2262)
Q180E3 5.26e-15 80 23 8 470 1 ribZ Riboflavin transporter RibZ Clostridioides difficile (strain 630)
P44927 1.58e-14 79 28 1 176 3 emrB Multidrug export protein EmrB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O35018 1.95e-14 79 25 12 442 3 lmrB Lincomycin resistance protein LmrB Bacillus subtilis (strain 168)
M1WG91 4.42e-14 78 28 12 358 3 CPUR_05422 MFS-type transporter CPUR_05422 Claviceps purpurea (strain 20.1)
P94422 1.88e-13 75 24 9 426 3 ycnB Uncharacterized MFS-type transporter YcnB Bacillus subtilis (strain 168)
P0AEJ0 4.45e-13 74 23 13 455 1 emrB Multidrug export protein EmrB Escherichia coli (strain K12)
P0AEJ1 4.45e-13 74 23 13 455 3 emrB Multidrug export protein EmrB Escherichia coli O157:H7
P94574 2.45e-12 72 28 4 191 3 ywoD Uncharacterized MFS-type transporter YwoD Bacillus subtilis (strain 168)
Q99S97 9.56e-11 67 24 13 425 1 sdrM Multidrug efflux pump SdrM Staphylococcus aureus (strain N315)
Q4WKA1 1.79e-10 66 22 10 414 2 mfsC Major facilitator superfamily multidrug transporter mfsC Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
M2YI75 1.97e-10 66 27 18 456 2 dotC Efflux pump dotC Dothistroma septosporum (strain NZE10 / CBS 128990)
A0A4Q4NMP3 2.54e-10 66 31 4 167 2 MFS54 MFS-type transporter MFS54 Alternaria alternata
A0A443HJZ5 4.3e-10 65 27 10 342 3 VdtG MFS-type transporter VdtG Byssochlamys spectabilis
Q8TFD3 4.93e-10 65 27 18 456 2 dotC Efflux pump dotC Dothistroma septosporum
A0A0E3D8L1 7.04e-10 64 22 12 360 3 PC-17 MFS-type transporter PC-17 Penicillium crustosum
B8NWW7 1.13e-09 63 24 12 390 3 lnaF MFS-type transporter lnaF Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0QWU7 1.42e-09 63 27 14 451 1 mfs Triacylglyceride transporter MSMEG_3069/MSMEI_2992 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P07561 2.16e-09 63 23 14 433 3 tet Tetracycline resistance protein Geobacillus stearothermophilus
Q0UI03 2.24e-09 63 25 9 290 2 elcC MFS-type efflux pump elcC Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
P0A4K6 2.99e-09 62 23 14 433 3 tet Tetracycline resistance protein Streptococcus pneumoniae
P0A4K8 2.99e-09 62 23 14 433 3 tet Tetracycline resistance protein Bacillus subtilis
P0A4K7 2.99e-09 62 23 14 433 3 tet Tetracycline resistance protein Bacillus cereus
Q0D1P6 4.45e-09 62 25 10 311 2 terG Efflux pump terG Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B7UMH7 4.67e-09 61 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P9WG85 4.71e-09 62 26 12 405 3 Rv1877 Uncharacterized MFS-type transporter Rv1877 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG84 4.71e-09 62 26 12 405 3 MT1926 Uncharacterized MFS-type transporter MT1926 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q10072 4.75e-09 62 30 4 171 3 SPAC3H1.06c Uncharacterized transporter C3H1.06c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HE13 6.01e-09 62 30 5 171 3 SPAC1399.02 Uncharacterized MFS-type transporter C1399.02 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A140JWS3 6.47e-09 62 25 6 213 3 ptmT MFS-type transporter ptmT Penicillium simplicissimum
A0A5B8YU71 7.55e-09 61 24 15 393 2 GME11371 MFS-type transporter GME11371 Pestalotiopsis microspora
Q1R4M4 7.97e-09 61 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain UTI89 / UPEC)
A1AHP3 7.97e-09 61 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O1:K1 / APEC
B7MGD1 7.97e-09 61 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O45:K1 (strain S88 / ExPEC)
A0A1E1FFK8 1.13e-08 61 30 5 171 3 prhG MFS-type transporter prhG Penicillium brasilianum
Q0D1P9 1.31e-08 60 24 15 430 2 terJ Efflux pump terJ Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B7NF27 1.36e-08 60 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
D4AXV8 1.46e-08 60 25 14 326 3 MFS1 MFS-type efflux pump MFS1 Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q0SYP9 1.55e-08 60 26 3 179 3 mdtL Multidrug resistance protein MdtL Shigella flexneri serotype 5b (strain 8401)
F2SH39 1.57e-08 60 24 12 325 2 MFS1 MFS-type efflux pump MFS1 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
B7M562 1.84e-08 60 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O8 (strain IAI1)
A7ZTR5 1.84e-08 60 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O139:H28 (strain E24377A / ETEC)
Q6GGX2 1.86e-08 60 23 11 401 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain MRSA252)
Q2UEK9 2.08e-08 60 27 13 355 2 astH MFS-type transporter astH Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q3YWK3 2.12e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Shigella sonnei (strain Ss046)
Q31UW4 2.12e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Shigella boydii serotype 4 (strain Sb227)
B2TUR5 2.12e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LL36 2.12e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain SMS-3-5 / SECEC)
B1IX28 2.12e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6H2 2.12e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O9:H4 (strain HS)
Q8FBV0 2.2e-08 59 27 4 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7N2F5 2.2e-08 59 27 4 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O81 (strain ED1a)
Q83PL6 2.22e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Shigella flexneri
B7LK52 2.22e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q0TAZ8 2.24e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8ACM0 2.55e-08 59 25 3 179 3 mdtL Multidrug resistance protein MdtL Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P23054 3.12e-08 59 24 17 423 3 tetB Tetracycline resistance protein Bacillus subtilis (strain 168)
B7NR12 3.33e-08 59 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B6I3U3 3.68e-08 58 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain SE11)
P31462 3.68e-08 58 26 3 179 1 mdtL Multidrug resistance protein MdtL Escherichia coli (strain K12)
B1X9T9 3.68e-08 58 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain K12 / DH10B)
C4ZYY8 3.68e-08 58 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain K12 / MC4100 / BW2952)
B7L855 3.68e-08 58 26 3 179 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain 55989 / EAEC)
A0A6F8RNA5 7.44e-08 58 28 4 171 3 grgE MFS-type transporter grgE Penicillium sp.
C8VQ97 7.86e-08 58 24 12 332 3 ausY MFS-type transporter ausY Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q6G9C6 8.44e-08 58 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain MSSA476)
Q8NWQ5 9.54e-08 57 24 12 403 1 norB Quinolone resistance protein NorB Staphylococcus aureus (strain MW2)
Q5HFY7 9.88e-08 57 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain COL)
A0A3G9H2R5 1.02e-07 58 21 8 412 1 cdmB MFS-type transporter cdmB Talaromyces verruculosus
A6TG19 1.04e-07 57 27 3 169 3 mdtL Multidrug resistance protein MdtL Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8Z415 1.12e-07 57 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain USA300 / TCH1516)
A6QGY6 1.12e-07 57 24 12 403 2 norB Quinolone resistance protein NorB Staphylococcus aureus (strain Newman)
Q2FYJ5 1.12e-07 57 24 12 403 1 norB Quinolone resistance protein NorB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH03 1.12e-07 57 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain USA300)
Q7A5M0 1.22e-07 57 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain N315)
Q99U52 1.22e-07 57 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ISW7 1.22e-07 57 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain JH9)
A6U1Q6 1.22e-07 57 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain JH1)
A7X2C6 1.22e-07 57 24 12 403 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain Mu3 / ATCC 700698)
A0A2V5HGL3 1.27e-07 57 28 5 182 3 ungB MFS-type transporter ungB Aspergillus violaceofuscus (strain CBS 115571)
K5B8L6 1.45e-07 57 27 15 421 1 C731_2106 Triacylglyceride transporter MHAS_02168/C731_2106 Mycolicibacterium hassiacum (strain DSM 44199 / CIP 105218 / JCM 12690 / 3849)
B6HJU0 1.64e-07 57 29 5 168 1 roqT Efflux pump roqT Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A4P8DK16 1.96e-07 57 28 1 118 3 dmxR4 MFS-type transporter dmxR4 Cryptosporiopsis sp. (strain 8999)
Q328Z8 2e-07 56 25 3 177 3 mdtL Multidrug resistance protein MdtL Shigella dysenteriae serotype 1 (strain Sd197)
A0R5K5 2.35e-07 56 28 11 422 2 lfrA Multidrug efflux pump LfrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0A0U5GJZ5 2.43e-07 57 25 11 330 3 ausY MFS-type transporter ausY Aspergillus calidoustus
A0A1L9WQV4 2.7e-07 56 29 7 214 2 ASPACDRAFT_1881869 Acurin A biosynthesis cluster MFS-type transporter Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
M1WCQ0 2.71e-07 56 24 10 330 2 tcpA MFS thioclapurine efflux transporter tcpA Claviceps purpurea (strain 20.1)
Q2YY45 3.92e-07 55 24 12 399 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6UEH3 4.17e-07 55 27 2 131 2 aflT Efflux pump aflT Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
B5YXB4 5.68e-07 55 25 3 177 3 mdtL Multidrug resistance protein MdtL Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XB24 5.68e-07 55 25 3 177 3 mdtL Multidrug resistance protein MdtL Escherichia coli O157:H7
O42922 6.47e-07 55 24 15 458 3 SPBC16A3.17c Uncharacterized MFS-type transporter C16A3.17c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A4P8W7F5 6.77e-07 55 24 17 472 3 pyiT MFS-type efflux transporter pyiT Pyricularia grisea
O34724 7.26e-07 55 26 4 167 3 yceJ Uncharacterized MFS-type transporter YceJ Bacillus subtilis (strain 168)
Q0D153 8.52e-07 55 28 1 160 2 ATEG_00331 MFS-type transporter ATEG_00331 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
W7MLD3 8.94e-07 55 27 7 214 3 FUS6 Efflux pump FUS6 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q8J0F3 1.11e-06 54 23 17 427 1 mlcE Efflux pump mlcE Penicillium citrinum
P32369 1.11e-06 54 26 4 165 3 baiG Bile acid transporter Clostridium scindens (strain JCM 10418 / VPI 12708)
Q9P6J7 1.73e-06 53 21 17 445 3 SPBC1683.03c Uncharacterized MFS-type transporter C1683.03c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B3FWS2 1.93e-06 53 25 4 176 3 hpm6 Efflux pump hmp6 Hypomyces subiculosus
P0C0L7 1.94e-06 53 26 3 141 1 proP Proline/betaine transporter Escherichia coli (strain K12)
P0C0L8 1.94e-06 53 26 3 141 3 proP Proline/betaine transporter Escherichia coli O157:H7
B1MCB5 1.94e-06 53 29 5 183 1 mfs Triacylglyceride transporter MAB_2807 Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
P36890 2.17e-06 53 22 15 434 3 tet Tetracycline resistance protein Staphylococcus hyicus
P13924 2.33e-06 53 22 14 433 3 tet Tetracycline resistance protein Streptococcus agalactiae
P0DPR7 2.36e-06 53 26 7 264 2 emrB Colistin resistance protein EmrB Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
S0EEY7 2.46e-06 53 26 7 212 2 FUS6 Efflux pump FUS6 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
G4MWA9 3.04e-06 53 27 7 213 2 MFS1 MFS-type efflux transporter MFS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
B5XZP2 3.74e-06 52 25 3 179 3 mdtL Multidrug resistance protein MdtL Klebsiella pneumoniae (strain 342)
I1RF56 3.99e-06 53 26 5 167 2 aurT Rubrofusarin-specific efflux pump aurT Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A9MJT5 4.78e-06 52 25 3 171 3 mdtL Multidrug resistance protein MdtL Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P9WJY3 4.87e-06 52 26 15 454 1 Rv1410c Triacylglyceride transporter Rv1410c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJY2 4.87e-06 52 26 15 454 3 MT1454 Triacylglyceride transporter MT1454 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
C6DTH3 4.87e-06 52 26 15 454 3 TBMG_02570 Triacylglyceride transporter TBMG_02570 Mycobacterium tuberculosis (strain KZN 1435 / MDR)
A5WM93 4.87e-06 52 26 15 454 3 TBFG_11439 Triacylglyceride transporter TBFG_11439 Mycobacterium tuberculosis (strain F11)
A5U2B2 4.87e-06 52 26 15 454 3 MRA_1419 Triacylglyceride transporter MRA_1419 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AN55 4.87e-06 52 26 15 454 3 JTY_1446 Probable triacylglyceride transporter JTY_1446 Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KIJ9 4.87e-06 52 26 15 454 1 BCG_1471c Probable triacylglyceride transporter BCG_1471c Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U042 4.87e-06 52 26 15 454 3 BQ2027_MB1445C Probable triacylglyceride transporter Mb1445c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WEP4 5.5e-06 52 24 12 311 3 olcL MFS-type transporter olcL Penicillium canescens
A0A6J4B6H5 6.08e-06 52 26 7 214 3 LUC4 MFS-type efflux pump LUC4 Fusarium sp.
C0Q2L5 7.04e-06 52 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella paratyphi C (strain RKS4594)
Q57HZ5 7.04e-06 52 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella choleraesuis (strain SC-B67)
P0A0J6 1e-05 51 25 4 192 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain MW2)
P0A0J7 1e-05 51 25 4 192 1 norA Quinolone resistance protein NorA Staphylococcus aureus
P0A0J5 1e-05 51 25 4 192 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain N315)
P0A0J4 1e-05 51 25 4 192 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HHX4 1e-05 51 25 4 192 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain COL)
P62967 1.03e-05 51 23 8 267 3 tet Tetracycline resistance protein Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P02983 1.03e-05 51 23 8 267 3 tet Tetracycline resistance protein Staphylococcus aureus
Q32EI1 1.15e-05 50 24 10 325 5 mdtD Putative multidrug resistance protein MdtD Shigella dysenteriae serotype 1 (strain Sd197)
Q6GBD5 1.15e-05 51 25 3 187 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain MSSA476)
A2RJJ9 1.27e-05 51 27 9 215 1 uriP Uridine/deoxyuridine transporter Lactococcus lactis subsp. cremoris (strain MG1363)
Q6GIU7 1.5e-05 50 25 4 192 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain MRSA252)
A0A1L7TV54 1.53e-05 51 24 8 266 2 FPY5 MFS-type transporter FPY5 Fusarium mangiferae
Q2UPC1 1.59e-05 51 26 7 221 3 aclA MFS efflux transporter aclA Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q8Z2N9 1.7e-05 50 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella typhi
Q4WF45 1.81e-05 50 35 2 80 2 mdr3 Major facilitator superfamily multidrug transporter mdr3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P45123 1.82e-05 50 27 8 202 3 bcr Bicyclomycin resistance protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P40862 1.93e-05 50 25 3 141 3 proP Proline/betaine transporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TAV4 1.96e-05 50 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella heidelberg (strain SL476)
B5BIM0 1.97e-05 50 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella paratyphi A (strain AKU_12601)
Q5PKV6 1.97e-05 50 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MX86 2.23e-05 50 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYB3 2.23e-05 50 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella newport (strain SL254)
B5EYX7 2.53e-05 50 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella agona (strain SL483)
A0A8F4NV97 2.64e-05 50 27 6 217 3 pydD MFS-type transporter pydD Acremonium sp.
P96709 2.82e-05 50 27 2 154 3 ydgK Uncharacterized MFS-type transporter YdgK Bacillus subtilis (strain 168)
Q6F5E3 3.04e-05 50 30 4 123 3 TP Aspyridones efflux protein Neocamarosporium betae
A0A0F7U0Z9 3.18e-05 50 27 5 166 3 ausY MFS-type transporter ausY Penicillium brasilianum
P9WJX3 3.19e-05 50 37 1 99 1 Rv1634 Probable multidrug-efflux transporter Rv1634 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJX2 3.19e-05 50 37 1 99 3 MT1670 Probable multidrug-efflux transporter MT1670 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8ZCH3 3.38e-05 50 26 6 182 3 nanT Sialic acid transporter NanT Yersinia pestis
Q1C5V2 3.38e-05 50 26 6 182 3 nanT Sialic acid transporter NanT Yersinia pestis bv. Antiqua (strain Antiqua)
Q87FV4 3.93e-05 49 29 5 174 3 mdtL Multidrug resistance protein MdtL Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B5QUQ6 3.95e-05 49 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella enteritidis PT4 (strain P125109)
B5FN15 3.95e-05 49 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella dublin (strain CT_02021853)
A0A1V6PBC8 4.3e-05 49 26 6 194 1 calB MFS-type transporter calB Penicillium decumbens
Q6C8F0 4.59e-05 49 26 6 210 3 CEX1 Citrate exporter 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
B4TN12 5.52e-05 48 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella schwarzengrund (strain CVM19633)
Q8ZKY1 5.82e-05 48 26 5 175 3 mdtL Multidrug resistance protein MdtL Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A142I724 5.97e-05 49 26 4 171 3 phomT MFS-type transporter phomT Diaporthe leptostromiformis
A0A2I1C3U4 6.08e-05 49 27 8 272 3 nsrN MFS-type transporter nsrN Aspergillus novofumigatus (strain IBT 16806)
A4TMJ0 7.79e-05 48 26 6 182 3 nanT Sialic acid transporter NanT Yersinia pestis (strain Pestoides F)
Q668K2 8.35e-05 48 26 6 182 3 nanT Sialic acid transporter NanT Yersinia pseudotuberculosis serotype I (strain IP32953)
A9QZJ2 8.35e-05 48 26 6 182 3 nanT Sialic acid transporter NanT Yersinia pestis bv. Antiqua (strain Angola)
B2K942 8.35e-05 48 26 6 182 3 nanT Sialic acid transporter NanT Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FG99 8.35e-05 48 26 6 182 3 nanT Sialic acid transporter NanT Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q9XXR3 8.82e-05 48 27 7 184 2 hmit-1.1 Proton myo-inositol cotransporter hmit-1.1 Caenorhabditis elegans
M2YMU2 9.06e-05 48 21 11 440 3 MYCFIDRAFT_190113 MFS-type transporter MYCFIDRAFT_190113 Pseudocercospora fijiensis (strain CIRAD86)
P50080 0.000128 48 25 2 157 1 AZR1 Azole resistance protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A2L0P0L8 0.000128 48 29 3 120 3 TwmF MFS-type transporter TwmF Talaromyces wortmannii
B1JFW5 0.000131 48 26 6 182 3 nanT Sialic acid transporter NanT Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P37489 0.000139 47 23 4 238 3 yybO Uncharacterized transporter YybO Bacillus subtilis (strain 168)
A0A7L8UVD5 0.000306 47 30 5 142 3 ffsH MFS-type efflux transporter ffsH Aspergillus flavipes
P28246 0.000315 46 27 2 147 1 bcr Bicyclomycin resistance protein Escherichia coli (strain K12)
P36172 0.000327 47 25 2 170 3 VBA5 Vacuolar basic amino acid transporter 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A0C1C354 0.000456 46 24 5 209 3 opaD MFS-type transporter opaD Aspergillus ustus
A0A411KUX1 0.000542 46 30 3 136 3 ucsD MFS-type transporter ucsD Acremonium sp.
P14551 0.000631 45 29 8 182 3 tetB Tetracycline resistance determinant Streptomyces rimosus
Q1RI77 0.000824 45 29 3 121 3 RBE_0856 Uncharacterized transporter RBE_0856 Rickettsia bellii (strain RML369-C)
A0A3G1DJE2 0.00088 45 23 12 419 3 L2 MFS transporter L2 Phoma sp. (strain ATCC 20986 / MF5453)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_03225
Feature type CDS
Gene araJ
Product putative arabinose efflux permease AraJ, MFS family
Location 635124 - 636545 (strand: -1)
Length 1422 (nucleotides) / 473 (amino acids)
In genomic island -

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2599
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF07690 Major Facilitator Superfamily

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2814 Carbohydrate transport and metabolism (G) G Predicted arabinose efflux permease AraJ, MFS family

Protein Sequence

MNQQQRIALFVLVLAGFVTIFDLFVVNVAIVSIERGLQASFTELTLIIAGYELAFGLLLITGGRLGDIYGRRRLYQAGMAFFTLASLLCAAAPTALLLVIARFIQGLAAALLFPQVYAGIRLNFDETQARKAFGWLGMTLGLAAIAGQALGGWLITLNLFDMSWRLIFLVNLPVGILALILSRHLQEGRAADGLTTDWPGVLLSAAGITAFLLPLLMLPVWGLTLLSTGLLLTGMVLLFCFVRYQQHLSRTGQTPLFDIAVLSNRPFVTGTGAVLCVYATSSAFPLILSLLLQNGMGATPLEAGLIFVPSSIGFVIASFITPRMIIGRGEPVIYYGALGYAASYLVLIAGLNFLPQSTANTILSLFLFLVGFTQGIIMTPMLNIVLSRVTPAQAGMASGLTATLQQIGAATGATAVSVILQFSLRHSGDTVLLSTPAAVYSVSLGFNVLMALCAAYLIYRITRARQPEIVSCL

Flanking regions ( +/- flanking 50bp)

CCTGATTATAGTCTCATTCCTGCTTTTAAAAATGGCAAAATGAGAAAAACATGAATCAGCAACAACGTATTGCACTGTTTGTATTAGTCCTCGCCGGGTTTGTCACTATTTTCGATCTGTTTGTCGTCAATGTGGCGATAGTCAGTATCGAACGTGGTTTACAGGCCAGTTTCACTGAACTGACACTGATTATTGCCGGGTATGAACTGGCTTTCGGCCTGCTGCTGATCACCGGCGGGCGGTTGGGCGATATTTACGGACGCCGCCGGTTATATCAGGCCGGAATGGCCTTTTTCACACTGGCGTCACTGTTGTGTGCTGCTGCACCGACAGCCTTATTACTGGTGATTGCCCGTTTTATCCAGGGACTGGCTGCCGCATTACTGTTCCCGCAGGTGTATGCCGGGATACGCCTGAATTTTGATGAAACACAGGCAAGAAAAGCATTCGGCTGGCTGGGGATGACGCTGGGGCTGGCCGCGATTGCCGGTCAGGCACTGGGGGGCTGGCTTATTACCCTGAATCTGTTTGATATGAGCTGGCGGCTGATTTTTCTGGTTAATCTCCCTGTTGGTATTCTGGCTCTGATATTGTCCCGCCATTTACAGGAGGGACGCGCTGCGGACGGACTCACCACCGACTGGCCGGGCGTACTGTTATCCGCTGCCGGAATTACCGCATTTCTGTTACCGCTTCTGATGTTACCGGTTTGGGGCCTGACACTTCTCAGTACCGGATTACTGCTTACGGGTATGGTTCTGTTGTTCTGTTTTGTCCGTTATCAGCAGCATTTATCACGCACCGGACAAACGCCGCTGTTTGATATTGCCGTACTGAGCAACCGGCCATTTGTTACCGGCACCGGCGCTGTGCTGTGTGTCTATGCCACCTCATCCGCATTTCCGCTGATACTTTCCCTGTTACTGCAAAACGGTATGGGGGCTACACCGCTGGAAGCCGGGCTGATTTTTGTACCGTCCAGTATCGGCTTTGTTATTGCCTCCTTTATTACCCCGCGAATGATTATCGGACGGGGCGAACCGGTGATTTATTACGGTGCATTAGGGTATGCCGCCAGTTATCTGGTATTAATTGCCGGGCTGAATTTCCTGCCGCAAAGCACCGCAAATACGATACTCAGTCTGTTTCTGTTTTTGGTCGGGTTCACACAGGGCATAATTATGACCCCGATGCTGAACATTGTGCTGTCCCGGGTTACACCGGCACAGGCCGGGATGGCATCCGGACTGACGGCCACATTACAACAGATTGGTGCGGCAACCGGTGCAACCGCAGTATCGGTTATTTTACAGTTTTCACTCCGGCACAGCGGAGATACGGTACTGTTATCCACCCCGGCCGCAGTTTACAGTGTCAGCCTCGGGTTCAATGTGCTGATGGCACTGTGTGCTGCATATCTGATTTACCGCATAACACGCGCCCGGCAGCCGGAAATAGTTTCCTGTCTGTAGTGCATCATTACGGATGTATTAAAAAAAGAAAATACCCCGAATTGTGTATT