Homologs in group_3201

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02490 FBDBKF_02490 100.0 Morganella morganii S1 mgtA magnesium-translocating P-type ATPase
NLDBIP_00500 NLDBIP_00500 100.0 Morganella morganii S4 mgtA magnesium-translocating P-type ATPase
LHKJJB_01535 LHKJJB_01535 100.0 Morganella morganii S3 mgtA magnesium-translocating P-type ATPase
HKOGLL_01575 HKOGLL_01575 100.0 Morganella morganii S5 mgtA magnesium-translocating P-type ATPase

Distribution of the homologs in the orthogroup group_3201

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3201

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P22036 0.0 1229 66 3 901 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ABB8 0.0 913 52 13 906 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 0.0 913 52 13 906 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
P36640 0.0 892 51 8 897 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 0.0 892 51 8 897 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
Q4WND5 9.7e-84 292 28 21 834 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q73E41 1.67e-83 290 28 25 892 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
O34431 4.89e-81 283 28 23 882 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
P98194 1.03e-80 283 26 20 825 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
Q64566 1.04e-80 283 27 20 825 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
O59868 2.93e-80 281 28 20 784 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q58623 6.69e-80 278 27 12 723 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P13586 1.71e-79 280 28 19 792 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5R5K5 2.02e-79 280 26 21 825 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
O43108 5.4e-79 278 27 20 795 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P57709 8.01e-79 278 26 20 825 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P9WPS9 1.21e-78 277 29 22 776 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 1.21e-78 277 29 22 776 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 1.21e-78 277 29 22 776 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A7L9Z8 6.4e-78 276 27 21 816 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
P37278 4.16e-77 273 27 24 837 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q80XR2 7.71e-77 272 26 19 825 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q8Y8Q5 9.13e-77 271 29 20 772 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8R4C1 1.65e-75 269 27 18 779 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
O75185 2.52e-74 266 27 19 782 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
Q9CFU9 5.65e-73 261 26 18 769 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q7PPA5 8.29e-72 259 28 31 880 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
P13607 9.87e-72 259 25 23 855 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13637 3.91e-71 257 27 27 820 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P28877 9.32e-71 254 27 15 730 1 PMA1 Plasma membrane ATPase 1 Candida albicans
P06687 1.74e-70 256 26 27 821 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 1.74e-70 256 26 27 821 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q9YGL9 3.33e-70 254 25 25 833 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
C1L360 5.88e-70 253 27 18 758 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
P22189 5.85e-69 251 25 25 888 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P24797 1.96e-68 249 26 26 808 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24798 2.23e-68 249 26 26 820 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P28774 3.85e-68 249 26 23 797 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
Q5RDR3 4.19e-68 249 27 29 819 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q8VDN2 5.8e-68 248 27 26 812 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
P35317 6.7e-68 248 26 23 784 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P05023 7.57e-68 248 27 30 819 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P06685 9.25e-68 248 27 26 812 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06686 1.37e-67 247 26 23 797 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 1.37e-67 247 26 23 797 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q92126 1.39e-67 247 26 23 803 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q9YH26 1.8e-67 247 27 27 819 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
P50993 2.03e-67 247 26 24 801 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
Q92123 4.04e-67 246 27 27 820 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q5RCD8 4.06e-67 246 26 24 803 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q9N0Z6 5.18e-67 246 27 28 819 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
P05024 6.53e-67 245 27 29 819 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P04074 6.91e-67 245 27 29 819 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
Q08DA1 8.28e-67 245 27 29 819 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P30714 1.15e-66 244 27 28 822 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
D2WKD8 2.45e-66 244 26 23 801 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
P18907 2.59e-66 243 27 29 817 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P47317 2.95e-66 241 29 20 721 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P58312 3.55e-66 243 26 25 822 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
Q13733 3.7e-66 243 27 23 723 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q9WV27 3.86e-66 243 25 25 827 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9XES1 3.97e-66 243 26 26 895 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
P05030 5.04e-66 241 25 16 769 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P05025 5.12e-66 243 27 27 817 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
A2VDL6 5.18e-66 243 26 23 801 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
Q64541 7.69e-66 242 25 26 831 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q6RWA9 9.77e-66 242 26 22 808 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q92030 1.91e-65 241 26 24 813 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
P49380 2.53e-65 239 26 18 776 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P09572 7.19e-65 239 26 25 782 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P50997 1.05e-64 239 27 28 826 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
Q43128 2.24e-64 237 27 21 828 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
Q9TV52 2.31e-64 238 26 21 803 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q7XB51 4.85e-64 236 26 21 774 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q92036 5.62e-64 237 25 23 823 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
P19657 5.79e-64 236 25 17 731 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P78036 7.03e-64 234 27 20 754 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P25489 2.67e-63 235 25 24 820 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P09626 3.39e-63 234 26 23 810 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P24545 5.5e-63 233 26 16 760 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
P50996 6e-63 234 26 23 802 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P54708 5.69e-62 231 25 25 804 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P27112 6.27e-62 231 26 23 807 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
Q64436 6.35e-62 231 26 23 807 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q9Z1W8 7.63e-62 231 26 23 798 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
P54707 7.68e-62 231 25 22 806 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54211 1.57e-61 230 26 23 794 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
P20648 1.89e-61 229 25 23 807 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
Q64392 2.08e-61 229 25 22 805 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
P19156 3.47e-61 229 25 23 807 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P11718 4.32e-61 228 27 24 796 2 H1A Probable proton ATPase 1A Leishmania donovani
P54679 6.07e-61 228 25 21 812 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
Q9SJB3 1.26e-60 226 26 17 778 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
Q9LY32 1.32e-60 226 28 16 719 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
Q9SH76 3.16e-60 225 27 18 717 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
P12522 3.34e-60 225 26 24 798 2 H1B Probable proton ATPase 1B Leishmania donovani
P19456 3.45e-60 225 27 15 728 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
P20649 4.92e-60 224 26 16 769 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
P09627 5.1e-60 224 26 20 769 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P17326 1.13e-59 224 24 21 805 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P07038 2.24e-59 222 25 16 731 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7XPY2 5.02e-59 221 27 18 711 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
Q9M2A0 1.44e-58 220 25 17 780 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
Q07421 1.93e-58 219 26 15 729 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
Q65X71 6.92e-58 219 25 22 784 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q03194 7.94e-58 218 27 15 704 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
P20431 1.64e-57 217 26 12 710 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
Q08436 2.27e-57 216 26 17 778 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
P92939 2.97e-57 217 26 29 893 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P83970 3.07e-56 213 25 21 826 2 ha1 Plasma membrane ATPase Triticum aestivum
Q08435 3.31e-56 213 26 21 785 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
P28876 4.9e-56 213 27 25 763 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9SU58 1.02e-55 212 27 20 782 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
Q42556 1.8e-55 211 26 16 693 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
Q2RAS0 1.94e-55 211 25 20 753 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q9LV11 4.33e-55 210 27 21 757 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
Q2QY12 5.69e-55 210 26 21 708 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
O22218 6.51e-55 210 24 26 883 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
P22180 9.31e-55 209 26 19 779 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
Q9M2L4 1.84e-54 208 24 28 883 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q2QMX9 1.54e-52 202 23 19 789 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
P9WPS5 1.57e-52 203 28 15 654 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS4 1.6e-52 203 28 15 669 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P35315 1.74e-52 202 25 26 855 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
O81108 2.73e-52 202 25 20 755 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
Q37145 3.09e-52 201 24 20 785 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q6ATV4 1e-51 200 24 23 812 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
P54210 1.49e-49 194 26 24 764 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
O64806 6.49e-49 191 25 20 712 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
Q9LF79 6.19e-48 188 26 25 786 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
O53114 1.16e-46 185 28 18 607 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
Q9LU41 7.67e-46 182 25 20 788 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
Q9LY77 2.94e-45 180 26 22 766 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
Q8RUN1 9.68e-45 178 24 15 670 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q9SZR1 1.24e-44 178 25 23 772 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q9HDW7 3.48e-43 174 27 20 688 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
J9VQQ3 5.01e-43 174 26 21 721 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q7XEK4 1.15e-41 169 26 24 788 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q9LIK7 2.22e-41 168 24 17 691 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
P37367 1.45e-40 165 31 7 357 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37367 4.76e-38 157 30 7 310 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P54678 4.95e-40 164 23 19 784 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P23980 3.43e-39 159 27 11 459 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
Q7X8B5 4.17e-39 160 26 19 676 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
P35597 6.63e-39 159 27 22 650 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0R3Y2 4.03e-38 156 24 16 610 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q08853 1.88e-37 155 25 13 482 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
Q08853 3.76e-29 129 28 8 347 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
P22700 2.94e-37 155 28 14 461 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
P22700 1.03e-29 130 30 15 405 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
O23087 4.93e-37 154 30 14 386 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O23087 2.27e-29 129 27 8 377 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
Q9SY55 1.35e-36 152 28 10 380 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q9SY55 1.88e-27 123 30 14 364 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q93084 1.42e-36 152 27 10 406 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q93084 1.11e-30 134 31 10 325 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q292Q0 2.51e-36 152 28 14 456 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q292Q0 1.82e-29 130 32 13 355 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
P18596 3.08e-36 151 27 10 391 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P18596 1.13e-31 137 32 11 325 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
O77696 3.93e-36 151 27 12 414 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
O77696 1.69e-31 136 32 11 325 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
Q42883 4.24e-36 151 27 10 354 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q42883 1.03e-30 134 30 12 391 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q64518 5.19e-36 150 27 11 395 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64518 6.94e-32 137 32 11 325 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
P70083 7.45e-36 150 26 10 438 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P70083 2.13e-28 126 28 11 356 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P9WPT0 9.22e-36 149 26 16 614 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPT1 9.81e-36 149 26 16 614 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 9.81e-36 149 26 16 614 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6Q477 1.27e-35 150 26 13 492 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
Q03669 1.78e-35 149 29 10 367 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q03669 5.11e-30 132 28 12 372 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
P54209 3.14e-35 148 29 12 381 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
P54209 1.08e-27 124 29 11 366 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
P16615 6.86e-35 147 29 7 340 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P16615 7.26e-31 134 30 10 323 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P11607 1.19e-34 146 28 7 340 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11607 7.71e-31 134 30 10 323 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
Q9R0K7 1.3e-34 147 24 28 793 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q64542 1.55e-34 146 26 13 492 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
Q64542 0.000191 49 27 4 163 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
O55143 2.17e-34 145 29 7 340 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
O55143 8.58e-31 134 30 10 323 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
P20647 2.57e-34 145 29 7 340 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P20647 6.49e-31 134 30 10 323 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P11507 2.64e-34 145 29 7 340 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P11507 8.35e-31 134 30 10 323 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
Q00779 2.84e-34 145 28 7 340 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q00779 7.3e-31 134 30 10 323 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
O46674 2.87e-34 145 28 7 340 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
O46674 7.36e-31 134 30 10 323 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
O13397 1.94e-33 142 25 6 357 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
O13397 9.8e-27 121 29 6 308 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
P35316 2.21e-33 142 29 9 360 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P35316 1.28e-27 124 30 11 353 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
O14983 2.6e-33 142 27 7 343 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O14983 5.81e-31 135 29 11 373 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
P13585 2.78e-33 142 28 8 343 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P13585 6.11e-30 131 28 11 373 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
Q0VCY0 3.27e-33 142 24 10 446 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q0VCY0 9.56e-30 130 28 11 373 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q64578 5.67e-33 141 27 7 343 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q64578 8.34e-30 131 28 11 373 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
P04191 5.98e-33 141 24 10 447 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P04191 4.55e-30 132 28 11 373 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
Q92105 6.68e-33 141 27 8 343 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q92105 1.07e-30 134 31 9 322 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q8R429 1.14e-32 140 27 7 343 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q8R429 8.63e-30 131 28 11 373 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
P23634 2.01e-32 140 25 14 512 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
D3K0R6 7.35e-32 138 25 18 532 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
Q4WHC8 1.07e-31 137 29 10 420 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WHC8 2.49e-29 129 28 10 371 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P58342 3.13e-31 135 25 19 597 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
Q64568 4.7e-31 135 25 18 533 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
Q64568 8.94e-06 53 24 9 255 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
Q16720 8.9e-31 134 25 18 533 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
Q16720 5.67e-06 54 24 9 255 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
Q4A0G1 3.37e-30 132 23 14 597 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O13398 3.38e-30 132 25 6 350 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O13398 6.15e-25 115 28 7 310 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
P13587 7.16e-30 131 26 9 402 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13587 1.46e-26 120 27 6 308 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9X5X3 1.02e-29 130 25 18 597 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q01896 1.24e-29 130 26 9 403 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 8.96e-27 121 27 6 308 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12691 1.31e-29 130 26 9 403 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12691 9.85e-27 121 27 6 308 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P11506 1.81e-29 130 25 17 535 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
P11505 2.01e-29 130 24 16 514 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
Q98SH2 2.06e-29 130 26 18 517 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
G5E829 2.23e-29 130 24 16 514 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
Q7A3E6 2.9e-29 129 25 18 594 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 2.9e-29 129 25 18 594 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 2.9e-29 129 25 18 594 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 2.9e-29 129 25 18 594 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 2.9e-29 129 25 18 594 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
P23220 3.02e-29 129 25 16 514 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
P20020 3.94e-29 129 25 16 514 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
A8Z3F8 4.37e-29 128 24 16 597 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 4.37e-29 128 24 16 597 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q6GDP1 6.19e-29 127 24 19 595 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
A6QK47 7.63e-29 127 24 19 595 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 7.63e-29 127 24 19 595 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 7.63e-29 127 24 19 595 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8NUQ9 9.01e-29 127 24 19 595 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 9.01e-29 127 24 19 595 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
P58341 1.12e-28 127 24 14 596 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
Q01814 1.32e-28 127 25 18 535 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
B9QMJ0 1.5e-28 127 26 21 491 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
B9QMJ0 6.89e-24 112 31 10 370 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
Q00804 2.8e-28 126 25 15 487 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
P58165 1.55e-27 124 25 16 499 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
Q2YWA3 3.19e-27 122 23 19 595 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CN02 5.46e-27 121 24 17 591 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 5.46e-27 121 24 17 591 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8XU11 8.98e-27 120 24 18 622 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
O32220 8.64e-26 117 24 15 582 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
Q8ZCA7 1.49e-25 117 24 22 622 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q5ZKB7 2.06e-25 117 23 21 707 2 ATP13A4 Probable cation-transporting ATPase 13A4 Gallus gallus
Q9SH30 3.21e-25 116 25 20 609 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
Q9T0E0 5.99e-25 115 23 12 489 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
Q9T0E0 1.15e-06 56 36 4 121 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
P37279 9.15e-25 114 24 21 665 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4L970 1.3e-24 114 23 16 588 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
G5EFR6 1.32e-24 114 24 20 543 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
Q59385 1.6e-24 114 25 22 604 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q6H7M3 1.72e-24 114 23 21 677 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
Q4LAI2 3.57e-24 112 23 20 619 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
Q8XD24 6.04e-24 112 25 22 604 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q8YPE9 8.48e-24 111 25 30 732 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q64430 9.41e-24 112 22 17 632 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q9R6X1 1.11e-23 110 23 25 730 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
P70705 1.43e-23 111 23 18 632 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
Q7N6W6 1.45e-23 110 25 16 610 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P38929 2.28e-23 110 27 10 354 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38929 1.05e-11 72 21 13 361 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5HK64 2.57e-23 109 23 20 619 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 2.57e-23 109 23 20 619 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 2.57e-23 109 23 20 619 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 2.57e-23 109 23 20 619 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q98GX6 2.58e-23 109 24 18 622 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9S7J8 3.04e-23 110 23 19 642 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
P9WPS3 3.84e-23 109 24 24 660 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 3.84e-23 109 24 24 660 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A143ZZK9 4.34e-23 109 27 10 369 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
A0A143ZZK9 2.49e-19 97 27 5 244 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
A0A0P0X004 1.45e-22 107 23 18 614 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q9XT50 1.54e-22 108 21 20 713 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q92XJ0 2.92e-22 106 24 21 664 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
C1EYK0 3.04e-22 106 23 20 621 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
A4W860 3.35e-22 106 24 21 627 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
A0RA13 5.55e-22 105 23 20 621 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
Q57RN0 6.6e-22 105 24 20 624 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
B7MPK0 7.07e-22 105 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
Q8FJV4 7.52e-22 105 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 7.52e-22 105 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UKX6 7.52e-22 105 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7HDF9 8.68e-22 104 24 25 664 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
C3LF99 9.46e-22 104 23 20 621 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q81HQ0 1.14e-21 104 24 25 664 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7ZXV8 1.18e-21 104 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
B7II09 1.31e-21 104 24 25 664 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
Q63FR0 1.35e-21 104 24 18 565 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
P73241 1.39e-21 104 22 16 618 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O32328 1.41e-21 103 24 20 571 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B5YQN9 1.43e-21 103 24 20 604 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 1.43e-21 103 24 20 604 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
Q6HN78 1.5e-21 103 23 20 621 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
A7GLG4 1.74e-21 103 23 17 588 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7HWG1 1.82e-21 103 23 20 620 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
Q8R8I6 2.06e-21 103 24 26 721 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A9VFM1 2.2e-21 103 24 27 668 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
B5EZE3 2.31e-21 103 24 23 629 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
P49015 2.43e-21 104 21 18 626 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
Q21286 2.43e-21 104 21 22 756 2 catp-5 Cation-transporting ATPase catp-5 Caenorhabditis elegans
B4U8E4 2.55e-21 103 25 22 578 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
B7LKR7 2.75e-21 103 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7N9U0 2.77e-21 103 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5BCA4 2.82e-21 103 24 22 627 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 2.82e-21 103 24 22 627 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q69HU0 3.02e-21 103 23 18 578 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
Q6GIX4 3.91e-21 102 23 18 578 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
B7NMQ0 4.06e-21 102 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LLE1 4.1e-21 102 24 18 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
B1IY32 4.17e-21 102 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q3Z4A6 4.59e-21 102 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
Q1REM0 5.18e-21 102 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 5.18e-21 102 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 5.18e-21 102 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
A8GB61 5.7e-21 102 25 17 574 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
Q324L0 5.95e-21 102 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
Q93MV5 7.47e-21 101 24 24 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
Q5HKB0 7.71e-21 101 23 15 567 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
C4LDL7 8.63e-21 101 24 22 669 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B4TBA6 9.11e-21 101 24 21 626 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 9.11e-21 101 24 21 626 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
A3AWA4 9.39e-21 102 23 18 595 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
A9MUE0 9.69e-21 101 24 20 624 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FNE0 1.03e-20 101 24 21 626 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
A8YZ02 1.04e-20 101 24 18 567 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 1.04e-20 101 24 18 567 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
B4SZB1 1.2e-20 101 24 21 626 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
B7M5L3 1.31e-20 100 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 1.31e-20 100 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
P03960 1.48e-20 100 25 19 568 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 1.48e-20 100 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 1.48e-20 100 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
B6HYQ5 1.53e-20 100 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 1.53e-20 100 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
B5R670 1.76e-20 100 24 21 626 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7JRB8 1.79e-20 100 23 20 621 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
B4TQ22 1.83e-20 100 24 20 624 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
Q8ZQW2 2.01e-20 100 23 20 624 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O31688 2.19e-20 100 22 16 563 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
Q8CQF7 2.45e-20 100 24 18 567 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9CCL1 3.25e-20 99 24 24 601 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
O14072 3.28e-20 100 22 23 639 1 cta4 Endoplasmic reticulum transmembrane helix translocase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q926K7 4.75e-20 99 23 22 678 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q4LAB1 9.99e-20 98 23 15 567 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
P59219 1.06e-19 98 24 15 583 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B2TTJ7 1.15e-19 98 25 19 568 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P57699 1.22e-19 98 24 20 578 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 1.22e-19 98 24 20 578 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9X8Z9 1.42e-19 97 23 17 608 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B5XZE9 1.49e-19 97 23 16 564 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
Q9NQ11 1.71e-19 98 23 22 713 1 ATP13A2 Polyamine-transporting ATPase 13A2 Homo sapiens
Q8KU73 2.06e-19 97 25 18 526 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q9KPZ7 2.1e-19 97 22 18 603 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CTG6 2.46e-19 97 22 19 707 2 Atp13a2 Polyamine-transporting ATPase 13A2 Mus musculus
A4SZG8 3.01e-19 96 22 17 670 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q9X5V3 3.3e-19 97 23 19 624 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
A6T6D8 3.49e-19 96 23 16 564 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P73867 3.7e-19 96 24 25 664 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A4TL06 4.7e-19 96 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 4.7e-19 96 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 4.7e-19 96 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 4.7e-19 96 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 4.7e-19 96 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 4.7e-19 96 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
Q667S4 5.78e-19 95 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
B1JR96 5.88e-19 95 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 5.88e-19 95 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q3TYU2 5.89e-19 96 23 29 754 2 Atp13a5 Probable cation-transporting ATPase 13A5 Mus musculus
P39986 6.2e-19 96 23 20 611 1 SPF1 Endoplasmic reticulum transmembrane helix translocase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A1JQS2 7.76e-19 95 24 17 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P32113 7.99e-19 95 35 2 169 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
P32113 2.24e-11 71 25 6 270 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q9RZP0 8.38e-19 95 24 22 628 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q72TM6 1.43e-18 94 24 15 561 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P9WPT5 2.9e-18 93 24 23 538 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 2.9e-18 93 24 23 538 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 2.9e-18 93 24 23 538 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P38995 3.49e-18 94 23 17 563 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9ZHC7 3.91e-18 93 33 1 163 1 silP Silver exporting P-type ATPase Salmonella typhimurium
Q9ZHC7 1.48e-08 62 22 11 326 1 silP Silver exporting P-type ATPase Salmonella typhimurium
B2HEM2 4.61e-18 93 23 24 596 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q47H39 7.17e-18 92 22 17 668 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
Q64446 1.11e-17 92 35 1 144 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q8U9D9 1.18e-17 91 23 16 605 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6GEZ7 1.45e-17 91 26 12 380 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
Q8NVI2 1.52e-17 91 26 13 380 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 1.52e-17 91 26 13 380 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
P63684 1.99e-17 90 26 12 380 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 1.99e-17 90 26 12 380 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A8Z4X9 2.08e-17 90 26 12 380 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 2.08e-17 90 26 12 380 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 2.08e-17 90 26 12 380 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
B2VJK3 2.42e-17 90 24 21 659 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9LT02 2.63e-17 91 22 22 609 1 PDR2 Probable manganese-transporting ATPase PDR2 Arabidopsis thaliana
Q2YUH7 3.65e-17 90 26 12 380 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9A7X7 3.69e-17 90 22 14 597 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P35670 6.86e-17 89 33 1 144 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
O29777 7.54e-17 89 36 2 163 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O29777 2.14e-05 52 25 11 277 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q0TRT3 8.13e-17 89 22 22 675 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q59465 8.46e-17 89 23 22 595 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
B2V2P3 1e-16 88 23 23 675 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
Q9ZL53 1.48e-16 88 23 22 639 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
P9WPU3 1.68e-16 87 23 23 660 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 1.68e-16 87 23 23 660 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 1.68e-16 87 23 23 660 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q64535 1.84e-16 88 34 1 144 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q8YSD5 2.01e-16 87 24 19 538 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P57698 2.75e-16 87 24 24 716 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04656 3.89e-16 87 32 1 159 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 0.000256 48 21 10 338 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
B2TMJ2 5.06e-16 86 23 26 679 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
P37385 1.07e-15 85 31 5 192 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P07893 1.08e-15 85 31 5 192 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P9WPU1 3.55e-15 84 31 3 181 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 3.55e-15 84 31 3 181 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q927G0 3.77e-15 83 25 19 561 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P46840 4.38e-15 83 32 3 183 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
Q8Y3Z7 5.7e-15 83 24 19 561 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71W90 7.07e-15 82 24 18 561 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 7.07e-15 82 24 18 561 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
B8DAW1 7.44e-15 82 24 18 561 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
O33533 8.38e-15 82 22 15 533 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
O59666 1.42e-14 82 22 16 591 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P57700 1.46e-14 81 21 17 639 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
O32219 2.39e-14 80 24 18 510 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
Q8Z8S4 2.6e-14 81 31 1 162 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8Z8S4 3.64e-09 64 26 11 281 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8ZR95 2.73e-14 80 31 1 162 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR95 5.72e-09 63 25 11 281 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q59998 3.48e-14 80 23 20 584 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O30085 4.04e-14 80 23 19 592 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A0AM16 5.54e-14 79 24 15 493 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P9WPT9 8.87e-14 79 33 3 178 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT8 9.75e-14 79 33 3 178 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 9.75e-14 79 33 3 178 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9SX33 1.1e-13 79 25 8 306 3 ALA9 Putative phospholipid-transporting ATPase 9 Arabidopsis thaliana
Q10309 1.7e-13 78 23 25 624 3 neo1 Phospholipid-transporting ATPase neo1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q97BF6 2.29e-13 77 20 18 641 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q8PCM1 3.38e-13 77 24 28 646 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P58414 5.26e-13 76 23 21 567 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P39524 6.32e-13 77 25 10 316 1 DRS2 Phospholipid-transporting ATPase DRS2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HD20 1.04e-12 76 21 22 601 1 ATP13A1 Endoplasmic reticulum transmembrane helix translocase Homo sapiens
Q3YW59 1.5e-12 75 26 12 363 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
Q3YW59 1.37e-06 55 34 3 109 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
P37617 2.19e-12 74 26 12 363 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
P37617 6.28e-07 57 34 3 109 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
Q8PPC9 4.27e-12 73 24 27 641 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
P77868 4.73e-12 73 27 1 161 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P90747 6.76e-12 73 21 19 618 3 catp-8 Probable manganese-transporting ATPase catp-8 Caenorhabditis elegans
Q9EPE9 1.43e-11 72 21 21 601 1 Atp13a1 Endoplasmic reticulum transmembrane helix translocase Mus musculus
Q5ZWR1 1.86e-11 71 30 3 164 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZWR1 9.88e-09 62 26 9 272 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8Z8E5 2.23e-11 71 25 9 337 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q8Z8E5 0.000569 47 27 7 169 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
O14022 3.74e-11 70 22 13 399 3 cta5 Cation-transporting ATPase 5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14022 2.14e-07 58 24 10 313 3 cta5 Cation-transporting ATPase 5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9GKS6 4.2e-11 70 27 12 296 2 ATP10D Phospholipid-transporting ATPase VD (Fragment) Macaca fascicularis
Q4VNC1 5.06e-11 70 26 10 275 1 ATP13A4 Probable cation-transporting ATPase 13A4 Homo sapiens
Q4VNC1 8.8e-10 66 24 6 282 1 ATP13A4 Probable cation-transporting ATPase 13A4 Homo sapiens
Q4VNC0 6.03e-11 70 22 22 592 1 ATP13A5 Probable cation-transporting ATPase 13A5 Homo sapiens
Q4VNC0 0.000471 47 30 3 101 1 ATP13A5 Probable cation-transporting ATPase 13A5 Homo sapiens
Q59467 7.29e-11 69 21 23 575 3 copA Copper-transporting ATPase Helicobacter pylori
Q5XF89 8.62e-11 70 22 23 598 1 Atp13a3 Polyamine-transporting ATPase 13A3 Mus musculus
A3BF39 1.59e-10 68 21 22 592 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
Q9SZC9 1.89e-10 68 22 15 558 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
Q6DFW5 2.17e-10 68 24 10 297 1 Atp11b Phospholipid-transporting ATPase IF Mus musculus
P46839 2.3e-10 68 33 2 152 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
P77871 3.75e-10 67 21 22 576 3 copA Copper-transporting ATPase Helicobacter pylori
P0CW78 3.93e-10 67 30 5 169 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
O08462 4.05e-10 67 26 4 220 3 copA Copper-transporting ATPase Helicobacter pylori
A0R3A7 5.35e-10 67 23 22 584 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P98198 6.73e-10 67 22 14 459 1 ATP8B2 Phospholipid-transporting ATPase ID Homo sapiens
Q9N0Z4 1.41e-09 65 24 9 286 1 ATP11B Phospholipid-transporting ATPase IF (Fragment) Oryctolagus cuniculus
P98205 1.74e-09 65 23 9 293 1 ALA2 Phospholipid-transporting ATPase 2 Arabidopsis thaliana
Q9Y2G3 1.82e-09 65 25 11 298 1 ATP11B Phospholipid-transporting ATPase IF Homo sapiens
Q95050 2.59e-09 65 20 18 489 2 TPA9 Probable cation-transporting ATPase 9 Tetrahymena thermophila
Q95050 8.23e-05 50 45 0 46 2 TPA9 Probable cation-transporting ATPase 9 Tetrahymena thermophila
P55989 2.76e-09 64 25 4 220 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q12697 2.84e-09 65 30 11 236 1 YPK9 Vacuolar cation-transporting ATPase YPK9 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12697 1.21e-08 63 23 8 284 1 YPK9 Vacuolar cation-transporting ATPase YPK9 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9RQB4 3.78e-09 64 31 5 171 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
Q9RQB4 5.86e-09 63 25 10 269 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
Q9LNQ4 5.54e-09 63 22 8 302 3 ALA4 Probable phospholipid-transporting ATPase 4 Arabidopsis thaliana
Q9SGG3 7.48e-09 63 22 8 304 3 ALA5 Probable phospholipid-transporting ATPase 5 Arabidopsis thaliana
Q9ZM69 8.89e-09 63 26 2 181 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q9SZW4 1.03e-08 63 28 3 150 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
Q9SZW4 4.14e-05 51 22 18 402 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
Q9LVK9 1.19e-08 62 22 6 302 3 ALA7 Probable phospholipid-transporting ATPase 7 Arabidopsis thaliana
Q5XF90 1.47e-08 62 23 11 327 1 Atp13a4 Probable cation-transporting ATPase 13A4 Mus musculus
Q5XF90 0.000529 47 50 0 48 1 Atp13a4 Probable cation-transporting ATPase 13A4 Mus musculus
Q9LK90 2.09e-08 62 23 9 313 3 ALA8 Probable phospholipid-transporting ATPase 8 Arabidopsis thaliana
P18398 2.2e-08 62 25 4 174 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
P18398 2.57e-05 52 24 7 265 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
B9DFX7 2.86e-08 61 25 4 186 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
Q8K2X1 3.25e-08 61 23 8 308 1 Atp10d Phospholipid-transporting ATPase VD Mus musculus
P57792 3.66e-08 61 28 3 159 3 ALA12 Probable phospholipid-transporting ATPase 12 Arabidopsis thaliana
Q9QZW0 4.62e-08 60 31 7 182 1 Atp11c Phospholipid-transporting ATPase 11C Mus musculus
Q9SLK6 4.86e-08 60 22 6 301 1 ALA6 Phospholipid-transporting ATPase 6 Arabidopsis thaliana
Q27533 5.09e-08 60 22 12 361 3 W08D2.5 Probable cation-transporting ATPase W08D2.5 Caenorhabditis elegans
Q27533 0.000128 49 29 4 144 3 W08D2.5 Probable cation-transporting ATPase W08D2.5 Caenorhabditis elegans
P05425 6.19e-08 60 27 1 141 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
P05425 3.67e-06 54 20 5 300 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q8NB49 6.45e-08 60 30 5 176 1 ATP11C Phospholipid-transporting ATPase IG Homo sapiens
O36028 7.1e-08 60 23 11 346 3 SPAC4F10.16c Phospholipid-transporting ATPase C4F10.16c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38360 8.12e-08 60 21 21 619 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4WYP6 1.02e-07 60 27 8 233 2 spfA Endoplasmic reticulum transmembrane helix translocase spfA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WYP6 3.84e-05 51 23 12 367 2 spfA Endoplasmic reticulum transmembrane helix translocase spfA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O94296 1.26e-07 59 20 7 293 3 SPBC887.12 Phospholipid-transporting ATPase C887.12 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P20021 1.32e-07 59 30 4 163 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
O75110 1.66e-07 59 26 12 264 1 ATP9A Probable phospholipid-transporting ATPase IIA Homo sapiens
P40527 1.79e-07 58 25 9 271 1 NEO1 Phospholipid-transporting ATPase NEO1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O64474 2.6e-07 58 26 4 167 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
Q9XIE6 2.93e-07 58 20 9 359 1 ALA3 Phospholipid-transporting ATPase 3 Arabidopsis thaliana
G5EBH1 3.01e-07 58 25 11 271 1 tat-5 Probable phospholipid-transporting ATPase tat-5 Caenorhabditis elegans
Q60048 3.49e-07 57 32 7 173 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
P30336 5.04e-07 57 30 4 163 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P98195 5.05e-07 57 26 13 279 1 Atp9b Probable phospholipid-transporting ATPase IIB Mus musculus
O74431 7.02e-07 57 26 12 271 3 SPCC1672.11c Probable cation-transporting ATPase C1672.11c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74431 1.62e-05 52 35 1 80 3 SPCC1672.11c Probable cation-transporting ATPase C1672.11c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
G0S196 7.3e-07 57 22 9 304 1 DNF1 Phospholipid-transporting ATPase DNF1 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q9LI83 7.56e-07 57 28 4 159 3 ALA10 Phospholipid-transporting ATPase 10 Arabidopsis thaliana
Q95JN5 8.4e-07 57 25 13 333 2 ATP13A3 Polyamine-transporting ATPase 13A3 Macaca fascicularis
Q9H7F0 8.62e-07 57 25 13 333 1 ATP13A3 Polyamine-transporting ATPase 13A3 Homo sapiens
Q6GIX1 8.88e-07 56 29 4 163 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
O70228 9.66e-07 56 25 12 264 1 Atp9a Probable phospholipid-transporting ATPase IIA Mus musculus
D4ABB8 1.17e-06 56 26 13 279 3 Atp9b Probable phospholipid-transporting ATPase IIB Rattus norvegicus
O32619 1.19e-06 56 23 1 163 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
P98197 1.35e-06 56 26 2 162 1 Atp11a Phospholipid-transporting ATPase IH Mus musculus
F1Q4S1 1.64e-06 55 27 14 281 3 atp9b Probable phospholipid-transporting ATPase IIB Danio rerio
Q9SAF5 2.26e-06 55 28 4 158 2 ALA11 Probable phospholipid-transporting ATPase 11 Arabidopsis thaliana
A1A4J6 3.16e-06 55 25 13 279 2 ATP9B Probable phospholipid-transporting ATPase IIB Bos taurus
O43861 3.42e-06 55 25 13 279 1 ATP9B Probable phospholipid-transporting ATPase IIB Homo sapiens
P37386 5.01e-06 54 29 4 163 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
Q59207 7.66e-06 53 22 7 367 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P98196 1.63e-05 52 27 3 162 1 ATP11A Phospholipid-transporting ATPase IH Homo sapiens
P98199 3.04e-05 52 25 8 252 1 Atp8b2 Phospholipid-transporting ATPase ID Mus musculus
P9WPT7 4.13e-05 51 29 2 124 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 4.13e-05 51 29 2 124 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P98204 8.41e-05 50 24 9 279 2 ALA1 Phospholipid-transporting ATPase 1 Arabidopsis thaliana
P86911 8.97e-05 47 40 2 83 1 None Sarcoplasmic/endoplasmic reticulum calcium ATPase (Fragments) Chionoecetes opilio
P9WPS7 0.000113 49 28 5 201 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 0.000113 49 28 5 201 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 0.000113 49 28 5 201 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9P241 0.000293 48 23 14 313 1 ATP10D Phospholipid-transporting ATPase VD Homo sapiens
P15718 0.000335 48 26 5 139 4 None Putative Pol polyprotein from transposon element Bs1 Zea mays
O60312 0.000411 48 26 9 228 1 ATP10A Phospholipid-transporting ATPase VA Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_02960
Feature type CDS
Gene mgtA
Product magnesium-translocating P-type ATPase
Location 581223 - 583919 (strand: 1)
Length 2697 (nucleotides) / 898 (amino acids)
In genomic island -

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3201
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00689 Cation transporting ATPase, C-terminus
PF00690 Cation transporter/ATPase, N-terminus
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0474 Inorganic ion transport and metabolism (P) P Magnesium-transporting ATPase (P-type)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01531 P-type Mg2+ transporter [EC:7.2.2.14] - -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG018402 Mg2+ transport protein VF0106 Nutritional/Metabolic factor

Protein Sequence

MTVNVNRTVTPAVRDNNAFPAAVYAAKTPDETLAELHSDMLGLDEIDALDRLIEHQENVVAHDKAPPAFIQFISAFHNPFIYVLLALAVISFMTDYLIPLQQGEDTDLTGVLIIGTMVFLSVVLRFWQEYRTNKAAEALKSLVKTTATVLRRKKGRSVRAELPVKCLVPGDIVVLSAGDMIPADLRLLRSRDLFISQAILTGESVPVEKYDTQGDIHEKDAATITENGQSLTESGNICLMGTNVASGTALGVVVATGDKTYFGSLAKSIVGTRSQTSFDRGVNSVSILLIRFMLVMVPVVLLINGFTKGDWFDATLFALAVAVGLTPEMLPMIVSSNLAKGAIAMSRRKVIVKRLNAIQNFGAMDILCTDKTGTLTQDNIILEHHLDTEGNTDEAILRLAWLNSFHQSGTRNLMDQAIIRFGRGKAETESLHNYQKIDELPFDFVRRRLSVSVRKPDGTALLICKGAAEEMLACCSLIRTGNHISPADDEKKQAIMALVNHYNETGFRVLLLAERVLDSKEQGLPLSADSEQNMILCGILTFLDPPKDSAAKALNALKHNGVTVKVLTGDNAVVTAKICREVGLDASMSISGDQLALLGDEELKQVAQTHTIFCKLTPLQKSVLVRILQSAGHTVGFLGDGINDAPALRDADVGISVDSGTDIAKESADIILLEKDLMVLEEGVIKGRETFGNIIKYLNMTASSNFGNVFSVLIASAFIPFLPMLAIQLLIQNLLYDMSQLALPWDKMDKEFLRKPRKWDAGNIRRFMIWIGPTSSVFDITTFALLWFVFGANSPDSQVLFHSGWFVEGLLSQTLVVHMLRTQRIPFIQSTATLPVLLVTGIVMAIGIWLPFSPIGSYIGLEPLPWEYFPWLAATLVSYCGLAQIMKGIYIRRFGMWL

Flanking regions ( +/- flanking 50bp)

GTGAAAAATAAATGACTCAGTTTATCTGAGGAAATAAAAGGAATCGTACCATGACTGTCAACGTTAACCGCACTGTCACTCCGGCTGTGCGCGATAATAATGCTTTCCCTGCGGCGGTATATGCCGCAAAAACACCAGACGAAACATTAGCAGAATTACATTCTGATATGCTGGGGCTGGATGAAATTGATGCCCTTGACCGCCTGATAGAACATCAGGAAAACGTGGTAGCACATGACAAAGCACCTCCCGCGTTTATTCAGTTTATTTCCGCATTTCATAATCCGTTTATTTATGTATTGCTGGCGCTGGCCGTTATCAGCTTTATGACGGATTATCTGATCCCCCTGCAACAGGGCGAAGACACTGACCTCACCGGTGTACTGATCATCGGAACGATGGTTTTTCTGAGTGTGGTACTGCGTTTCTGGCAGGAATACCGGACCAACAAAGCCGCAGAAGCCCTGAAATCACTGGTAAAAACCACTGCCACAGTACTCCGGCGTAAAAAAGGACGATCTGTCCGGGCAGAACTGCCGGTAAAATGTCTGGTTCCGGGGGATATAGTAGTTCTGAGCGCCGGGGATATGATACCGGCGGACTTGCGGCTGCTCCGTTCCCGTGATCTTTTTATCAGCCAGGCCATTCTGACCGGGGAATCGGTTCCGGTAGAGAAATATGATACTCAGGGCGATATCCATGAAAAAGATGCCGCAACGATAACGGAAAACGGACAATCACTGACGGAATCGGGCAATATCTGCCTGATGGGCACCAATGTGGCCAGCGGCACGGCACTGGGTGTTGTGGTGGCAACCGGTGACAAAACCTATTTTGGCTCACTGGCGAAATCCATTGTCGGAACACGCTCACAGACGTCATTCGATCGCGGGGTGAATAGTGTCAGTATCCTGCTGATCCGCTTTATGTTAGTGATGGTGCCGGTTGTCCTGCTGATTAACGGATTTACCAAAGGCGACTGGTTTGATGCCACACTCTTTGCACTTGCCGTCGCAGTCGGGTTAACCCCGGAAATGCTGCCGATGATTGTCAGTTCGAACCTGGCGAAAGGCGCAATTGCAATGTCGCGGCGGAAAGTTATCGTTAAGCGGCTGAATGCAATACAAAACTTTGGCGCAATGGATATCCTGTGCACGGATAAAACAGGAACGCTGACACAGGATAATATTATCCTCGAGCATCATCTTGATACGGAGGGTAATACCGATGAAGCCATACTGAGACTGGCGTGGCTGAACAGTTTTCACCAGAGTGGCACACGTAACCTGATGGATCAGGCGATCATCCGTTTCGGGCGCGGTAAAGCCGAAACAGAGTCTCTGCACAATTATCAGAAAATTGACGAACTGCCGTTTGATTTTGTCCGCAGACGTCTGTCTGTATCCGTAAGAAAACCGGATGGTACCGCCTTGCTTATCTGTAAAGGTGCGGCGGAAGAGATGCTGGCGTGCTGTTCTCTGATCCGGACCGGAAATCATATTTCTCCTGCGGATGATGAGAAAAAACAGGCCATTATGGCGCTGGTCAATCATTACAATGAGACCGGATTCAGAGTACTGCTGCTCGCAGAGCGGGTTCTGGATAGCAAAGAGCAGGGATTGCCGCTCTCCGCAGACAGTGAACAAAATATGATTTTATGCGGAATTCTGACCTTCCTGGATCCGCCGAAAGACAGTGCGGCAAAAGCGCTTAACGCACTGAAGCATAACGGGGTAACCGTAAAAGTGCTTACCGGGGACAATGCGGTTGTCACAGCAAAAATCTGTCGTGAAGTCGGGCTGGATGCCTCGATGAGTATCAGTGGTGATCAATTGGCGCTCCTCGGTGATGAGGAACTGAAACAGGTGGCGCAAACACACACTATTTTCTGTAAACTGACACCGCTGCAAAAATCAGTCCTGGTCAGGATTTTGCAATCCGCCGGACATACCGTTGGTTTTCTCGGGGACGGCATTAATGACGCGCCGGCATTACGGGACGCGGATGTCGGAATTTCCGTGGACAGCGGAACGGATATCGCGAAAGAATCCGCTGATATTATCCTGCTGGAAAAAGATCTGATGGTTCTGGAGGAGGGTGTCATTAAAGGGCGCGAGACATTCGGTAATATTATTAAATACCTGAATATGACCGCCAGCTCTAACTTCGGTAATGTATTTTCTGTTCTTATCGCCAGTGCCTTTATTCCGTTCCTGCCGATGCTGGCCATTCAGTTACTGATTCAGAACCTGCTTTATGATATGTCTCAGCTTGCGCTGCCGTGGGATAAAATGGATAAAGAATTCCTGCGCAAACCCCGTAAATGGGATGCGGGCAATATCCGGCGCTTTATGATCTGGATTGGCCCGACATCGTCTGTATTTGATATCACCACCTTTGCATTATTATGGTTTGTTTTCGGGGCAAACAGTCCGGACAGTCAGGTTTTATTCCATTCCGGCTGGTTTGTTGAGGGGTTATTATCACAAACGCTGGTCGTGCATATGCTGAGAACACAACGGATCCCGTTTATTCAGAGCACAGCAACACTGCCGGTATTATTGGTTACCGGGATTGTTATGGCCATCGGGATCTGGCTGCCGTTTTCACCAATCGGAAGTTATATCGGGCTTGAGCCGTTACCGTGGGAATATTTCCCGTGGCTTGCTGCTACGCTGGTCAGCTATTGCGGTCTGGCACAAATCATGAAGGGTATTTATATCCGCCGTTTCGGAATGTGGCTGTAAGTTAAGATATGTTGTACCTGTTATTCAGCTGATTTTTACTGAATAACAGG