Homologs in group_519

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01100 FBDBKF_01100 100.0 Morganella morganii S1 pepB aminopeptidase PepB
NLDBIP_03015 NLDBIP_03015 100.0 Morganella morganii S4 pepB aminopeptidase PepB
LHKJJB_04530 LHKJJB_04530 100.0 Morganella morganii S3 pepB aminopeptidase PepB
HKOGLL_02515 HKOGLL_02515 100.0 Morganella morganii S5 pepB aminopeptidase PepB
F4V73_RS07170 F4V73_RS07170 92.3 Morganella psychrotolerans pepB aminopeptidase PepB
PMI_RS09145 PMI_RS09145 73.7 Proteus mirabilis HI4320 pepB aminopeptidase PepB

Distribution of the homologs in the orthogroup group_519

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_519

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N231 0.0 686 75 1 430 3 pepB Peptidase B Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GHX6 0.0 618 70 1 430 3 pepB Peptidase B Serratia proteamaculans (strain 568)
B5RD05 0.0 616 69 1 421 3 pepB Peptidase B Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R595 0.0 616 69 1 421 3 pepB Peptidase B Salmonella enteritidis PT4 (strain P125109)
B5FR78 0.0 616 69 1 421 3 pepB Peptidase B Salmonella dublin (strain CT_02021853)
Q9RF52 0.0 615 69 1 421 1 pepB Peptidase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4N3 0.0 615 69 1 421 3 pepB Peptidase B Salmonella typhi
C0PYL4 0.0 615 69 1 421 3 pepB Peptidase B Salmonella paratyphi C (strain RKS4594)
A9N1Y3 0.0 615 69 1 421 3 pepB Peptidase B Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T0R5 0.0 615 69 1 421 3 pepB Peptidase B Salmonella newport (strain SL254)
B5F1B3 0.0 615 69 1 421 3 pepB Peptidase B Salmonella agona (strain SL483)
Q6D266 0.0 615 67 2 435 3 pepB Peptidase B Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8AD60 0.0 613 69 1 421 3 pepB Peptidase B Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q57LH5 0.0 613 69 1 421 3 pepB Peptidase B Salmonella choleraesuis (strain SC-B67)
A6TCE4 0.0 611 69 1 421 3 pepB Peptidase B Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9MHK1 0.0 610 69 1 421 3 pepB Peptidase B Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XNK4 0.0 607 69 1 421 3 pepB Peptidase B Klebsiella pneumoniae (strain 342)
A7MGW9 0.0 605 68 1 421 3 pepB Peptidase B Cronobacter sakazakii (strain ATCC BAA-894)
Q0T1Z6 0.0 603 69 1 421 3 pepB Peptidase B Shigella flexneri serotype 5b (strain 8401)
Q83QK5 0.0 603 69 1 421 3 pepB Peptidase B Shigella flexneri
B5Z0Z6 0.0 603 69 1 421 3 pepB Peptidase B Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58473 0.0 603 69 1 421 3 pepB Peptidase B Escherichia coli O157:H7
A7ZPW6 0.0 602 69 1 421 3 pepB Peptidase B Escherichia coli O139:H28 (strain E24377A / ETEC)
B1JRZ6 0.0 602 70 1 432 3 pepB Peptidase B Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TMU7 0.0 602 70 1 432 3 pepB Peptidase B Yersinia pestis (strain Pestoides F)
Q1CKA2 0.0 602 70 1 432 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Nepal516)
A9R811 0.0 602 70 1 432 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Angola)
P58475 0.0 602 70 1 432 1 pepB Peptidase B Yersinia pestis
Q1C5H7 0.0 602 70 1 432 3 pepB Peptidase B Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFX8 0.0 602 70 1 432 3 pepB Peptidase B Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q3YZ29 0.0 602 69 1 421 3 pepB Peptidase B Shigella sonnei (strain Ss046)
B6I595 0.0 602 69 1 421 3 pepB Peptidase B Escherichia coli (strain SE11)
B7M7M6 0.0 602 69 1 421 3 pepB Peptidase B Escherichia coli O8 (strain IAI1)
B7LDB5 0.0 602 69 1 421 3 pepB Peptidase B Escherichia coli (strain 55989 / EAEC)
Q667Y8 0.0 602 70 1 432 3 pepB Peptidase B Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K9R0 0.0 602 70 1 432 3 pepB Peptidase B Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q32D41 0.0 601 68 1 421 3 pepB Peptidase B Shigella dysenteriae serotype 1 (strain Sd197)
Q1R8K9 0.0 601 69 1 421 3 pepB Peptidase B Escherichia coli (strain UTI89 / UPEC)
A1AE61 0.0 601 69 1 421 3 pepB Peptidase B Escherichia coli O1:K1 / APEC
B7MI07 0.0 601 69 1 421 3 pepB Peptidase B Escherichia coli O45:K1 (strain S88 / ExPEC)
B7N6B0 0.0 601 68 1 421 3 pepB Peptidase B Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IWD8 0.0 601 69 1 421 3 pepB Peptidase B Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A329 0.0 601 69 1 421 3 pepB Peptidase B Escherichia coli O9:H4 (strain HS)
B7LKB6 0.0 600 68 1 421 3 pepB Peptidase B Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8FF47 0.0 600 69 1 421 3 pepB Peptidase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEW2 0.0 600 69 1 421 3 pepB Peptidase B Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MYF7 0.0 600 69 1 421 3 pepB Peptidase B Escherichia coli O81 (strain ED1a)
B7UGW9 0.0 600 69 1 421 3 pepB Peptidase B Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q31XW7 0.0 599 68 1 421 3 pepB Peptidase B Shigella boydii serotype 4 (strain Sb227)
B2TXU8 0.0 599 68 1 421 3 pepB Peptidase B Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LNH8 0.0 599 68 1 421 3 pepB Peptidase B Escherichia coli (strain SMS-3-5 / SECEC)
P37095 0.0 598 68 1 421 1 pepB Peptidase B Escherichia coli (strain K12)
B1XAZ8 0.0 598 68 1 421 3 pepB Peptidase B Escherichia coli (strain K12 / DH10B)
C4ZX98 0.0 598 68 1 421 3 pepB Peptidase B Escherichia coli (strain K12 / MC4100 / BW2952)
A4WDA4 0.0 597 68 1 421 3 pepB Peptidase B Enterobacter sp. (strain 638)
C6DBI4 0.0 595 67 2 435 3 pepB Peptidase B Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B7NRH2 0.0 591 68 1 421 3 pepB Peptidase B Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7VJT3 0.0 522 59 2 426 3 pepB Peptidase B Vibrio atlanticus (strain LGP32)
Q9KTX5 0.0 520 58 1 425 3 pepB Peptidase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A7MU37 0.0 520 59 2 428 3 pepB Peptidase B Vibrio campbellii (strain ATCC BAA-1116)
Q87S21 0.0 518 60 2 426 3 pepB Peptidase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CM16 7.88e-178 506 58 2 428 3 pepB Peptidase B Pasteurella multocida (strain Pm70)
Q7MNF5 8.02e-178 506 58 2 428 3 pepB Peptidase B Vibrio vulnificus (strain YJ016)
Q8DEZ4 8.02e-178 506 58 2 428 3 pepB Peptidase B Vibrio vulnificus (strain CMCP6)
P58474 4.48e-177 504 57 3 432 5 pepB Putative peptidase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QM33 8.18e-176 501 57 3 432 3 pepB Peptidase B Haemophilus influenzae (strain 86-028NP)
Q3A831 9.94e-68 226 42 8 323 3 pepA Probable cytosol aminopeptidase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5X1Q9 8.03e-67 224 41 5 312 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Paris)
Q5WTG8 4.1e-66 222 40 5 312 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Lens)
A5IAU5 1.22e-65 220 40 5 312 3 pepA Probable cytosol aminopeptidase Legionella pneumophila (strain Corby)
B7HUR5 2.11e-63 215 40 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain AH187)
A7NG41 5.28e-63 214 41 7 317 3 pepA Probable cytosol aminopeptidase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B9J3C5 8.23e-63 213 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain Q1)
Q632E1 8.86e-63 213 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ZK / E33L)
Q72YG1 9.64e-63 213 40 9 325 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ATCC 10987 / NRS 248)
C1DPG2 1.64e-62 213 39 8 347 3 pepA Probable cytosol aminopeptidase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A7GUC8 2.05e-62 212 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
C1EX85 2.22e-62 212 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain 03BB102)
A0RKB5 2.22e-62 212 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus thuringiensis (strain Al Hakam)
B7JDH9 2.36e-62 212 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain AH820)
Q81XS5 2.36e-62 212 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus anthracis
C3LC57 2.36e-62 212 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PDF7 2.36e-62 212 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus anthracis (strain A0248)
Q7UJ62 3.33e-62 212 40 8 318 3 pepA Probable cytosol aminopeptidase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q6HBY2 3.34e-62 212 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7IMU0 3.95e-62 211 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain G9842)
B7HBG1 5.83e-62 211 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain B4264)
A8FH04 6.1e-62 211 37 10 357 3 pepA Probable cytosol aminopeptidase Bacillus pumilus (strain SAFR-032)
Q816E3 7.28e-62 211 39 8 323 3 pepA Probable cytosol aminopeptidase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C3K6G5 8.28e-62 211 38 6 327 3 pepA Probable cytosol aminopeptidase Pseudomonas fluorescens (strain SBW25)
Q88P73 8.56e-62 211 39 6 326 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2T0C0 1.31e-61 210 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B3ED46 1.74e-61 210 42 7 322 3 pepA Probable cytosol aminopeptidase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B0KQK8 1.75e-61 210 39 6 326 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain GB-1)
Q63WC3 4e-61 209 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain K96243)
A3N6U4 4e-61 209 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 668)
A3NSI1 4e-61 209 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 1106a)
Q3JV16 4.4e-61 209 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia pseudomallei (strain 1710b)
A1V5Z5 5.04e-61 209 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain SAVP1)
Q62LH2 5.04e-61 209 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain ATCC 23344)
A2SAC2 5.04e-61 209 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain NCTC 10229)
A3MLR1 5.04e-61 209 40 7 325 3 pepA Probable cytosol aminopeptidase Burkholderia mallei (strain NCTC 10247)
Q0SQ50 5.2e-61 209 39 6 315 3 pepA Probable cytosol aminopeptidase Clostridium perfringens (strain SM101 / Type A)
A5VZ69 6.72e-61 208 38 6 326 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A9AHG9 6.98e-61 208 39 7 326 3 pepA Probable cytosol aminopeptidase Burkholderia multivorans (strain ATCC 17616 / 249)
O86436 7.01e-61 208 38 6 326 1 pepA Cytosol aminopeptidase Pseudomonas putida
A9VMY8 7.28e-61 208 38 8 323 3 pepA Probable cytosol aminopeptidase Bacillus mycoides (strain KBAB4)
B1JBA9 8.56e-61 208 38 6 325 3 pepA Probable cytosol aminopeptidase Pseudomonas putida (strain W619)
A4ISE0 9.02e-61 208 40 8 317 3 pepA Probable cytosol aminopeptidase Geobacillus thermodenitrificans (strain NG80-2)
Q1I5F9 1.03e-60 208 39 6 322 3 pepA Probable cytosol aminopeptidase Pseudomonas entomophila (strain L48)
Q8XHI3 1.41e-60 207 39 6 315 3 pepA Probable cytosol aminopeptidase Clostridium perfringens (strain 13 / Type A)
A4JGZ2 1.44e-60 207 39 7 326 3 pepA Probable cytosol aminopeptidase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q3KHM4 1.54e-60 207 38 6 325 3 pepA Probable cytosol aminopeptidase Pseudomonas fluorescens (strain Pf0-1)
Q39DS5 1.7e-60 207 38 8 346 3 pepA Probable cytosol aminopeptidase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2KA77 2.53e-60 207 37 6 320 3 pepA Probable cytosol aminopeptidase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
C5D720 2.81e-60 207 38 9 341 3 pepA Probable cytosol aminopeptidase Geobacillus sp. (strain WCH70)
B1JWV2 8.49e-60 206 37 8 346 3 pepA Probable cytosol aminopeptidase Burkholderia orbicola (strain MC0-3)
B4E8G9 1.01e-59 205 39 7 326 3 pepA Probable cytosol aminopeptidase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0RUA5 1.02e-59 205 37 6 329 3 pepA Probable cytosol aminopeptidase Cenarchaeum symbiosum (strain A)
B2JET5 1.24e-59 205 39 7 326 3 pepA Probable cytosol aminopeptidase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q0BCQ2 1.45e-59 205 38 6 326 3 pepA Probable cytosol aminopeptidase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1BUE7 1.64e-59 205 37 8 346 3 pepA Probable cytosol aminopeptidase Burkholderia orbicola (strain AU 1054)
A0K9N9 1.64e-59 205 37 8 346 3 pepA Probable cytosol aminopeptidase Burkholderia cenocepacia (strain HI2424)
B3PUV3 1.7e-59 204 37 6 320 3 pepA Probable cytosol aminopeptidase Rhizobium etli (strain CIAT 652)
A5EIB4 1.86e-59 204 38 8 328 3 pepA Probable cytosol aminopeptidase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q8UGC8 1.88e-59 204 38 7 317 3 pepA Probable cytosol aminopeptidase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6DA52 2.01e-59 204 39 7 323 3 pepA Probable cytosol aminopeptidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1YUW5 3.02e-59 204 38 6 326 3 pepA Probable cytosol aminopeptidase Burkholderia ambifaria (strain MC40-6)
Q92QY7 3.63e-59 204 37 6 316 3 pepA Probable cytosol aminopeptidase Rhizobium meliloti (strain 1021)
Q82X54 3.71e-59 204 37 5 320 3 pepA Probable cytosol aminopeptidase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q488M4 3.72e-59 204 37 7 343 3 pepA Probable cytosol aminopeptidase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q1MIZ4 4.38e-59 204 37 6 320 3 pepA Probable cytosol aminopeptidase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A4SSA7 4.45e-59 204 38 6 319 3 pepA Probable cytosol aminopeptidase Aeromonas salmonicida (strain A449)
Q8KD74 4.94e-59 204 41 6 317 3 pepA Probable cytosol aminopeptidase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A3N1A7 5.19e-59 203 38 8 342 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q1IPU7 6.17e-59 204 38 7 321 3 pepA Probable cytosol aminopeptidase Koribacter versatilis (strain Ellin345)
Q606B9 6.26e-59 203 38 5 318 3 pepA Probable cytosol aminopeptidase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q4ZXH7 6.6e-59 203 38 6 324 3 pepA Probable cytosol aminopeptidase Pseudomonas syringae pv. syringae (strain B728a)
A1BGN2 7.59e-59 203 40 5 317 3 pepA Probable cytosol aminopeptidase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8RHT8 7.74e-59 202 36 8 325 3 pepA Probable cytosol aminopeptidase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A8ML24 7.82e-59 203 38 7 317 3 pepA Probable cytosol aminopeptidase Alkaliphilus oremlandii (strain OhILAs)
B4F2N1 8.79e-59 203 38 9 344 3 pepA Probable cytosol aminopeptidase Proteus mirabilis (strain HI4320)
A4G7P5 1.02e-58 203 37 6 326 3 pepA Probable cytosol aminopeptidase Herminiimonas arsenicoxydans
Q135P8 1.12e-58 202 38 8 326 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisB5)
C3M9C8 1.24e-58 202 37 7 317 3 pepA Probable cytosol aminopeptidase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B5ZWY7 1.25e-58 202 36 6 320 3 pepA Probable cytosol aminopeptidase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q07LG0 1.25e-58 202 38 6 320 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisA53)
Q7VNH9 1.29e-58 202 38 6 323 3 pepA Probable cytosol aminopeptidase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6T0V4 1.68e-58 202 37 6 326 3 pepA Probable cytosol aminopeptidase Janthinobacterium sp. (strain Marseille)
Q2YB18 1.91e-58 202 37 5 317 3 pepA Probable cytosol aminopeptidase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A1WUV1 1.99e-58 202 39 5 325 3 pepA Probable cytosol aminopeptidase Halorhodospira halophila (strain DSM 244 / SL1)
Q887M0 2.55e-58 201 39 6 320 3 pepA Probable cytosol aminopeptidase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B5EKZ2 2.81e-58 201 40 7 335 3 pepA Probable cytosol aminopeptidase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J5I9 2.81e-58 201 40 7 335 3 pepA Probable cytosol aminopeptidase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q7VAP4 2.92e-58 201 38 9 343 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q6AFG2 3.14e-58 201 40 7 324 3 pepA Probable cytosol aminopeptidase Leifsonia xyli subsp. xyli (strain CTCB07)
A6X259 3.28e-58 201 37 8 338 3 pepA Probable cytosol aminopeptidase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q89MT4 3.42e-58 201 38 7 325 3 pepA Probable cytosol aminopeptidase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A1SRZ1 3.47e-58 201 36 5 319 3 pepA Probable cytosol aminopeptidase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A6U7J2 3.57e-58 201 37 6 316 3 pepA Probable cytosol aminopeptidase Sinorhizobium medicae (strain WSM419)
B9JCD8 5.9e-58 201 37 6 316 3 pepA Probable cytosol aminopeptidase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q11HH5 6.89e-58 200 37 7 318 3 pepA Probable cytosol aminopeptidase Chelativorans sp. (strain BNC1)
A4VNZ7 7.27e-58 200 38 6 324 3 pepA Probable cytosol aminopeptidase Stutzerimonas stutzeri (strain A1501)
Q2IX74 7.28e-58 200 37 7 324 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain HaA2)
Q2NR41 1.03e-57 200 38 6 319 3 pepA Probable cytosol aminopeptidase Sodalis glossinidius (strain morsitans)
B1JLS9 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66F09 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQP6 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pestis (strain Pestoides F)
Q1CM01 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5F5 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBH3 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pestis
B2K3E9 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C3R8 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FML9 1.12e-57 200 38 6 325 3 pepA Probable cytosol aminopeptidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q029J4 1.19e-57 199 37 8 340 3 pepA Probable cytosol aminopeptidase Solibacter usitatus (strain Ellin6076)
Q8YG99 1.43e-57 199 37 7 317 3 pepA Probable cytosol aminopeptidase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C6DJN2 1.48e-57 200 38 7 323 3 pepA Probable cytosol aminopeptidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q1H4U4 1.54e-57 199 36 5 324 3 pepA Probable cytosol aminopeptidase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q02RY8 1.61e-57 199 39 6 323 1 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8G1M4 1.63e-57 199 37 7 317 3 pepA Probable cytosol aminopeptidase Brucella suis biovar 1 (strain 1330)
C3LR42 1.68e-57 199 38 7 325 3 pepA Probable cytosol aminopeptidase Vibrio cholerae serotype O1 (strain M66-2)
P0C6E1 1.68e-57 199 38 7 325 3 pepA Cytosol aminopeptidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5D8 1.68e-57 199 38 7 325 3 pepA Cytosol aminopeptidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B8GTX6 1.73e-57 199 36 6 338 3 pepA Probable cytosol aminopeptidase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A5VPM3 2.09e-57 199 37 7 317 3 pepA Probable cytosol aminopeptidase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A0KPF3 2.19e-57 199 37 6 319 3 pepA Probable cytosol aminopeptidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q6FFD8 2.51e-57 199 37 7 359 3 pepA Probable cytosol aminopeptidase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0AIF5 4.13e-57 198 36 5 324 3 pepA Probable cytosol aminopeptidase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3SS04 5.84e-57 198 37 6 327 3 pepA Probable cytosol aminopeptidase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
O68822 5.89e-57 198 38 6 323 3 pepA Cytosol aminopeptidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVT6 5.89e-57 198 38 6 323 3 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain LESB58)
A5UBH1 5.95e-57 198 38 7 326 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain PittEE)
Q4QJN7 5.95e-57 198 38 7 326 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain 86-028NP)
Q8EI85 9.15e-57 197 42 11 326 3 pepA1 Probable cytosol aminopeptidase 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B3GXY6 9.25e-57 197 38 8 342 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
P45334 9.42e-57 197 38 7 326 3 pepA Cytosol aminopeptidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C0QC86 9.81e-57 198 41 9 322 3 pepA Probable cytosol aminopeptidase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
C4K346 1.09e-56 197 37 4 322 3 pepA Probable cytosol aminopeptidase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q4UKD7 1.12e-56 197 37 9 322 3 pepA Probable cytosol aminopeptidase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q215R8 1.39e-56 197 37 6 325 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain BisB18)
A5UFE2 1.52e-56 197 38 7 326 3 pepA Probable cytosol aminopeptidase Haemophilus influenzae (strain PittGG)
B0BQ37 1.68e-56 197 38 6 323 3 pepA Probable cytosol aminopeptidase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q68XM6 2.18e-56 196 36 7 321 3 pepA Probable cytosol aminopeptidase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A7IFB7 2.47e-56 196 38 9 323 3 pepA Probable cytosol aminopeptidase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A8FS02 2.49e-56 196 37 7 337 3 pepA Probable cytosol aminopeptidase Shewanella sediminis (strain HAW-EB3)
Q15PX4 2.68e-56 196 37 7 324 3 pepA Probable cytosol aminopeptidase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
C4LA51 2.92e-56 196 38 6 319 3 pepA Probable cytosol aminopeptidase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A6V0T2 3.95e-56 196 38 6 323 3 pepA Probable cytosol aminopeptidase Pseudomonas aeruginosa (strain PA7)
A5CRI6 4.03e-56 196 39 7 323 3 pepA Probable cytosol aminopeptidase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q6LUW0 4.2e-56 196 36 7 324 3 pepA Probable cytosol aminopeptidase Photobacterium profundum (strain SS9)
A8F0Q0 4.21e-56 196 36 8 322 3 pepA Probable cytosol aminopeptidase Rickettsia massiliae (strain Mtu5)
Q6N5B9 4.34e-56 196 36 9 338 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B3Q9R8 4.92e-56 196 36 9 338 3 pepA Probable cytosol aminopeptidase Rhodopseudomonas palustris (strain TIE-1)
C4K1N6 6e-56 195 37 9 322 3 pepA Probable cytosol aminopeptidase Rickettsia peacockii (strain Rustic)
A7MSE5 6.32e-56 195 37 7 322 3 pepA Probable cytosol aminopeptidase Vibrio campbellii (strain ATCC BAA-1116)
Q143Y9 6.5e-56 196 39 7 326 3 pepA Probable cytosol aminopeptidase Paraburkholderia xenovorans (strain LB400)
B1LVC3 7.86e-56 195 37 7 318 3 pepA Probable cytosol aminopeptidase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q92J85 1.01e-55 195 37 9 322 3 pepA Probable cytosol aminopeptidase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PMI0 1.01e-55 195 37 9 322 3 pepA Probable cytosol aminopeptidase Rickettsia africae (strain ESF-5)
B2T146 1.05e-55 195 39 7 326 3 pepA Probable cytosol aminopeptidase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q83P64 1.18e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Shigella flexneri
B7LMT2 1.22e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q328S1 1.34e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Shigella dysenteriae serotype 1 (strain Sd197)
Q31TK2 1.35e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Shigella boydii serotype 4 (strain Sb227)
B2TYY4 1.35e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3YU89 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Shigella sonnei (strain Ss046)
Q0SXK0 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Shigella flexneri serotype 5b (strain 8401)
Q1R2Z4 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain UTI89 / UPEC)
B1LRE5 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain SMS-3-5 / SECEC)
B6I2H3 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain SE11)
B7NGJ2 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P68767 1.49e-55 194 37 6 319 1 pepA Cytosol aminopeptidase Escherichia coli (strain K12)
B1ISB1 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P68766 1.49e-55 194 37 6 319 3 pepA Cytosol aminopeptidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T9D1 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AJG3 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O1:K1 / APEC
A8A816 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O9:H4 (strain HS)
B1XEN9 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain K12 / DH10B)
C4ZRD1 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M9L9 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O8 (strain IAI1)
B7MSZ3 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O81 (strain ED1a)
B7NUH4 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3L7 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P68768 1.49e-55 194 37 6 319 3 pepA Cytosol aminopeptidase Escherichia coli O157:H7
B7LCX0 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli (strain 55989 / EAEC)
B7MLR5 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UQR7 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZVE0 1.49e-55 194 37 6 319 3 pepA Probable cytosol aminopeptidase Escherichia coli O139:H28 (strain E24377A / ETEC)
P28838 1.55e-55 195 37 5 321 1 LAP3 Cytosol aminopeptidase Homo sapiens
B8J457 1.6e-55 194 39 8 318 3 pepA Probable cytosol aminopeptidase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
C1F4B7 1.73e-55 194 39 11 360 3 pepA Probable cytosol aminopeptidase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q12QW7 1.81e-55 194 36 7 337 3 pepA Probable cytosol aminopeptidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
O32106 1.83e-55 194 40 9 317 3 pepA Probable cytosol aminopeptidase Bacillus subtilis (strain 168)
B9JUW1 1.95e-55 194 37 6 316 3 pepA Probable cytosol aminopeptidase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B0CCF6 2.08e-55 194 37 9 314 3 pepA Probable cytosol aminopeptidase Acaryochloris marina (strain MBIC 11017)
Q87LG8 2.1e-55 194 37 6 321 3 pepA Probable cytosol aminopeptidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B2VL42 2.16e-55 194 37 7 320 3 pepA Probable cytosol aminopeptidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q1LJJ6 2.18e-55 194 36 5 322 3 pepA Probable cytosol aminopeptidase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A5GN62 2.19e-55 194 38 7 325 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain WH7803)
A0PTP9 2.66e-55 194 38 7 322 3 pepA Probable cytosol aminopeptidase Mycobacterium ulcerans (strain Agy99)
Q7M8W6 2.7e-55 193 36 6 325 3 pepA Probable cytosol aminopeptidase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A8GQW7 3.09e-55 193 33 12 404 3 pepA Probable cytosol aminopeptidase Rickettsia rickettsii (strain Sheila Smith)
B0BWB2 3.09e-55 193 33 12 404 3 pepA Probable cytosol aminopeptidase Rickettsia rickettsii (strain Iowa)
A8EXL1 3.22e-55 193 36 8 321 3 pepA Probable cytosol aminopeptidase Rickettsia canadensis (strain McKiel)
A8AMA5 3.32e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q7MZ27 3.42e-55 193 38 7 320 3 pepA Probable cytosol aminopeptidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B8D7Q4 3.92e-55 193 36 6 336 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
A4WRK9 3.97e-55 193 36 6 337 3 pepA Probable cytosol aminopeptidase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q0I816 4.14e-55 193 37 7 327 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9311)
Q8ZK29 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TTA0 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella schwarzengrund (strain CVM19633)
B5BKS6 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi A (strain AKU_12601)
C0Q7D6 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi C (strain RKS4594)
A9N680 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJD4 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T3M4 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella newport (strain SL254)
B4TG58 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella heidelberg (strain SL476)
B5R9L5 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1K2 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella enteritidis PT4 (strain P125109)
B5FSH0 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella dublin (strain CT_02021853)
Q57GC3 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella choleraesuis (strain SC-B67)
B5F465 4.78e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella agona (strain SL483)
B2HGY2 4.81e-55 193 38 7 322 3 pepA Probable cytosol aminopeptidase Mycobacterium marinum (strain ATCC BAA-535 / M)
A9MET9 5.58e-55 193 38 6 319 3 pepA Probable cytosol aminopeptidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8GXC3 6.6e-55 192 35 7 319 3 pepA Probable cytosol aminopeptidase Rickettsia bellii (strain OSU 85-389)
Q5E7T8 7.17e-55 192 37 6 324 3 pepA Probable cytosol aminopeptidase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B8D9F2 7.18e-55 192 36 6 336 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q1RJN2 7.64e-55 192 35 7 319 3 pepA Probable cytosol aminopeptidase Rickettsia bellii (strain RML369-C)
P57448 8.14e-55 192 36 6 336 3 pepA Cytosol aminopeptidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q31ET3 8.51e-55 192 31 15 427 3 pepA Probable cytosol aminopeptidase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q823J9 9.42e-55 192 38 6 312 3 pepA Probable cytosol aminopeptidase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q46XT9 1.23e-54 192 36 7 324 3 pepA Probable cytosol aminopeptidase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
C6E543 1.29e-54 192 35 7 363 3 pepA Probable cytosol aminopeptidase Geobacter sp. (strain M21)
Q7MHG4 1.35e-54 192 36 5 324 3 pepA Probable cytosol aminopeptidase Vibrio vulnificus (strain YJ016)
Q8DCE5 1.35e-54 192 36 5 324 3 pepA Probable cytosol aminopeptidase Vibrio vulnificus (strain CMCP6)
B8CU18 1.35e-54 192 36 7 337 3 pepA Probable cytosol aminopeptidase Shewanella piezotolerans (strain WP3 / JCM 13877)
P57823 1.36e-54 192 36 10 374 3 pepA Probable cytosol aminopeptidase Pasteurella multocida (strain Pm70)
Q9JTI8 1.37e-54 191 40 10 319 3 pepA Probable cytosol aminopeptidase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q984S1 1.43e-54 192 36 7 324 3 pepA Probable cytosol aminopeptidase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P00727 1.68e-54 192 38 7 321 1 LAP3 Cytosol aminopeptidase Bos taurus
B5F9Q6 1.78e-54 191 36 7 325 3 pepA Probable cytosol aminopeptidase Aliivibrio fischeri (strain MJ11)
B6EMT2 1.85e-54 191 36 7 324 3 pepA Probable cytosol aminopeptidase Aliivibrio salmonicida (strain LFI1238)
Q68FS4 1.98e-54 192 38 7 321 1 Lap3 Cytosol aminopeptidase Rattus norvegicus
A7Z8B5 2.08e-54 191 38 9 317 3 pepA Probable cytosol aminopeptidase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8NNJ4 2.41e-54 191 38 6 316 3 pepA Probable cytosol aminopeptidase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
C5BBY4 3.02e-54 191 37 6 319 3 pepA Probable cytosol aminopeptidase Edwardsiella ictaluri (strain 93-146)
A8G978 3.11e-54 191 36 6 324 3 pepA Probable cytosol aminopeptidase Serratia proteamaculans (strain 568)
A4WF25 3.21e-54 191 37 6 319 3 pepA Probable cytosol aminopeptidase Enterobacter sp. (strain 638)
A5G9C7 3.26e-54 191 36 7 322 3 pepA Probable cytosol aminopeptidase Geotalea uraniireducens (strain Rf4)
B3R663 3.34e-54 191 36 5 322 3 pepA Probable cytosol aminopeptidase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q73QZ3 3.37e-54 190 35 10 350 3 pepA Probable cytosol aminopeptidase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
B3QNM5 3.6e-54 191 39 6 317 3 pepA Probable cytosol aminopeptidase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B0UVX4 3.73e-54 191 35 6 323 3 pepA Probable cytosol aminopeptidase Histophilus somni (strain 2336)
Q9CPY7 3.77e-54 191 38 7 321 1 Lap3 Cytosol aminopeptidase Mus musculus
A1JJ31 3.79e-54 191 37 6 324 3 pepA Probable cytosol aminopeptidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3B4B5 3.98e-54 191 40 6 322 3 pepA Probable cytosol aminopeptidase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q9A7M9 4.06e-54 190 37 8 323 3 pepA Probable cytosol aminopeptidase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A8G6E3 4.91e-54 190 36 10 344 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9215)
Q8Z116 5.19e-54 190 37 6 319 3 pepA Probable cytosol aminopeptidase Salmonella typhi
Q0K7F5 6.81e-54 190 37 7 324 3 pepA Probable cytosol aminopeptidase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0I236 6.98e-54 190 33 7 373 3 pepA Probable cytosol aminopeptidase Histophilus somni (strain 129Pt)
Q47BG9 8.4e-54 189 36 5 316 3 pepA Probable cytosol aminopeptidase Dechloromonas aromatica (strain RCB)
B8HTK3 8.87e-54 189 38 12 332 3 pepA Probable cytosol aminopeptidase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q5QY05 9.11e-54 189 36 5 322 3 pepA Probable cytosol aminopeptidase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A3Q1S2 9.48e-54 190 36 5 323 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain JLS)
P27888 1e-53 189 35 7 321 3 pepA Cytosol aminopeptidase Rickettsia prowazekii (strain Madrid E)
Q8K9I0 1.05e-53 189 40 6 285 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8EH62 1.05e-53 189 36 7 337 3 pepA2 Probable cytosol aminopeptidase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B8F6N9 1.06e-53 189 36 7 323 3 pepA Probable cytosol aminopeptidase Glaesserella parasuis serovar 5 (strain SH0165)
B5Y2T8 1.22e-53 189 38 6 319 3 pepA Probable cytosol aminopeptidase Klebsiella pneumoniae (strain 342)
A3QBG2 1.39e-53 189 37 6 323 3 pepA Probable cytosol aminopeptidase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q1QKW6 1.47e-53 189 36 6 326 3 pepA Probable cytosol aminopeptidase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q1B6R7 1.56e-53 189 36 5 323 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain MCS)
A1UIA8 1.56e-53 189 36 5 323 3 pepA Probable cytosol aminopeptidase Mycobacterium sp. (strain KMS)
A6THI2 1.73e-53 189 38 6 319 3 pepA Probable cytosol aminopeptidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q74GB4 2.17e-53 188 39 6 321 3 pepA Probable cytosol aminopeptidase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q5L681 2.21e-53 189 38 6 312 3 pepA Probable cytosol aminopeptidase Chlamydia abortus (strain DSM 27085 / S26/3)
Q0AB75 2.36e-53 188 36 6 329 3 pepA Probable cytosol aminopeptidase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B2UAK8 2.5e-53 188 38 7 323 3 pepA Probable cytosol aminopeptidase Ralstonia pickettii (strain 12J)
Q0VSA5 3.07e-53 188 37 7 324 3 pepA Probable cytosol aminopeptidase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q65FE6 3.15e-53 188 37 8 322 3 pepA Probable cytosol aminopeptidase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A2BSQ4 3.66e-53 187 36 10 344 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain AS9601)
Q5NXM1 3.75e-53 188 36 6 322 3 pepA Probable cytosol aminopeptidase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q3JEC8 4.07e-53 188 36 7 324 3 pepA Probable cytosol aminopeptidase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q2SKR0 4.45e-53 187 38 7 323 3 pepA Probable cytosol aminopeptidase Hahella chejuensis (strain KCTC 2396)
Q086N8 4.51e-53 188 36 6 327 3 pepA Probable cytosol aminopeptidase Shewanella frigidimarina (strain NCIMB 400)
C1AQC8 4.73e-53 188 38 8 323 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KKQ5 4.73e-53 188 38 8 323 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7VEN5 4.73e-53 188 38 8 323 3 pepA Probable cytosol aminopeptidase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A5CXK2 5.08e-53 187 37 7 293 3 pepA Probable cytosol aminopeptidase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q11A96 5.14e-53 187 37 6 319 3 pepA Probable cytosol aminopeptidase Trichodesmium erythraeum (strain IMS101)
Q6NG90 5.4e-53 187 37 6 322 3 pepA Probable cytosol aminopeptidase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6K669 6.79e-53 189 37 10 327 2 Os02g0794700 Leucine aminopeptidase 2, chloroplastic Oryza sativa subsp. japonica
P28839 9.7e-53 187 37 6 319 1 LAP3 Cytosol aminopeptidase Sus scrofa
Q893F8 1.26e-52 186 34 11 384 3 pepA Probable cytosol aminopeptidase Clostridium tetani (strain Massachusetts / E88)
Q8DI46 1.42e-52 186 38 8 314 3 pepA Probable cytosol aminopeptidase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q73IU2 1.43e-52 186 35 7 320 3 pepA Probable cytosol aminopeptidase Wolbachia pipientis wMel
Q7NHC6 1.47e-52 186 35 7 320 3 pepA Probable cytosol aminopeptidase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P9WHT3 1.61e-52 186 37 7 322 1 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHT2 1.61e-52 186 37 7 322 3 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U4P1 1.61e-52 186 37 7 322 3 pepA Probable cytosol aminopeptidase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q9Z8F8 2.06e-52 186 37 8 315 3 pepA Probable cytosol aminopeptidase Chlamydia pneumoniae
C1AUB5 2.57e-52 186 39 7 317 3 pepA Probable cytosol aminopeptidase Rhodococcus opacus (strain B4)
B1V932 2.66e-52 186 34 5 339 3 pepA Probable cytosol aminopeptidase Phytoplasma australiense
B0VMG3 2.71e-52 185 41 4 254 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain SDF)
B0VDC8 2.77e-52 185 41 4 254 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AYE)
A3M1A8 2.77e-52 185 41 4 254 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I1U0 2.77e-52 185 41 4 254 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain ACICU)
B7I309 2.77e-52 185 41 4 254 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AB0057)
B7H1P9 2.77e-52 185 41 4 254 3 pepA Probable cytosol aminopeptidase Acinetobacter baumannii (strain AB307-0294)
Q2JRU4 2.86e-52 186 39 7 320 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain JA-3-3Ab)
C5CCM4 3.14e-52 186 39 7 334 3 pepA Probable cytosol aminopeptidase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
A6VMX3 3.17e-52 185 36 9 330 3 pepA Probable cytosol aminopeptidase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7V5X8 3.25e-52 185 40 10 322 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9313)
Q254B9 3.29e-52 185 38 6 312 3 pepA Probable cytosol aminopeptidase Chlamydia felis (strain Fe/C-56)
O32956 3.3e-52 186 37 6 319 3 pepA Probable cytosol aminopeptidase Mycobacterium leprae (strain TN)
C5BMG6 3.53e-52 186 36 6 307 3 pepA Probable cytosol aminopeptidase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q5FU70 4.05e-52 185 37 10 312 3 pepA Probable cytosol aminopeptidase Gluconobacter oxydans (strain 621H)
B1ZAK8 5.05e-52 185 36 8 318 3 pepA Probable cytosol aminopeptidase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
P30184 5.29e-52 185 36 10 336 1 LAP1 Leucine aminopeptidase 1 Arabidopsis thaliana
Q0SHL0 5.38e-52 185 39 7 317 3 pepA Probable cytosol aminopeptidase Rhodococcus jostii (strain RHA1)
B7KYK4 5.9e-52 184 37 8 318 3 pepA Probable cytosol aminopeptidase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q7VGF0 7.31e-52 184 34 4 321 3 pepA Probable cytosol aminopeptidase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2KWX0 8.41e-52 184 38 7 326 3 pepA Probable cytosol aminopeptidase Bordetella avium (strain 197N)
B3R0N4 8.48e-52 184 34 7 321 3 pepA Probable cytosol aminopeptidase Phytoplasma mali (strain AT)
Q319F5 9.99e-52 184 36 9 329 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9312)
A9VXD6 1.04e-51 184 37 8 318 3 pepA Probable cytosol aminopeptidase Methylorubrum extorquens (strain PA1)
C0QSL9 1.11e-51 184 36 8 325 3 pepA Probable cytosol aminopeptidase Persephonella marina (strain DSM 14350 / EX-H1)
A6TWW9 1.38e-51 184 37 5 314 3 pepA Probable cytosol aminopeptidase Alkaliphilus metalliredigens (strain QYMF)
Q83G32 1.39e-51 184 38 6 321 3 pepA Probable cytosol aminopeptidase Tropheryma whipplei (strain Twist)
Q83I32 1.39e-51 184 38 6 321 3 pepA Probable cytosol aminopeptidase Tropheryma whipplei (strain TW08/27)
A3PEG6 1.42e-51 183 35 10 344 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9301)
P38019 1.73e-51 183 38 6 313 3 pepA Probable cytosol aminopeptidase Chlamydia muridarum (strain MoPn / Nigg)
Q7NTY9 1.81e-51 184 37 7 321 3 pepA Probable cytosol aminopeptidase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q315M7 2.3e-51 183 35 8 331 3 pepA Probable cytosol aminopeptidase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8XWQ8 2.46e-51 183 37 7 325 3 pepA Probable cytosol aminopeptidase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7VQT0 2.52e-51 183 37 5 291 3 pepA Probable cytosol aminopeptidase Blochmanniella floridana
O84049 2.54e-51 183 38 6 313 1 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q1LTH8 3.03e-51 183 36 8 319 3 pepA Probable cytosol aminopeptidase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q944P7 3.16e-51 184 35 12 339 2 LAP2 Leucine aminopeptidase 2, chloroplastic Arabidopsis thaliana
Q8D295 3.32e-51 183 33 9 343 3 pepA Probable cytosol aminopeptidase Wigglesworthia glossinidia brevipalpis
B6JGL8 3.72e-51 182 36 6 316 3 pepA Probable cytosol aminopeptidase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q65SA3 4.36e-51 182 35 10 370 3 pepA Probable cytosol aminopeptidase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B9MJ44 6.29e-51 182 38 8 324 3 pepA Probable cytosol aminopeptidase Acidovorax ebreus (strain TPSY)
Q7U8Q1 8.16e-51 181 36 7 346 3 pepA Probable cytosol aminopeptidase Parasynechococcus marenigrum (strain WH8102)
B1VZN5 9.38e-51 182 38 11 377 3 pepA Probable cytosol aminopeptidase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q6A9W5 1.18e-50 181 38 8 338 3 pepA Probable cytosol aminopeptidase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q3KMX6 1.4e-50 181 37 6 314 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
A1W776 1.58e-50 181 38 8 324 3 pepA Probable cytosol aminopeptidase Acidovorax sp. (strain JS42)
O67868 1.69e-50 181 36 10 325 3 pepA Probable cytosol aminopeptidase Aquifex aeolicus (strain VF5)
C5CLU5 2.19e-50 181 35 9 326 3 pepA Probable cytosol aminopeptidase Variovorax paradoxus (strain S110)
Q8FNP8 3.32e-50 180 37 7 334 3 pepA Probable cytosol aminopeptidase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B0BB32 3.64e-50 180 37 6 313 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9F3 3.64e-50 180 37 6 313 3 pepA Probable cytosol aminopeptidase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q5XGB9 9.26e-50 179 37 5 287 2 lap3 Cytosol aminopeptidase Xenopus tropicalis
Q2QSB9 9.68e-50 180 35 10 348 3 Os12g0434400 Putative leucine aminopeptidase 1 Oryza sativa subsp. japonica
Q7W5K6 1.04e-49 179 39 7 326 3 pepA Probable cytosol aminopeptidase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VW48 1.06e-49 179 39 7 326 3 pepA Probable cytosol aminopeptidase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WD42 1.06e-49 179 39 7 326 3 pepA Probable cytosol aminopeptidase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A9BBV5 1.16e-49 178 35 11 357 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus (strain MIT 9211)
B1XK83 1.28e-49 178 37 6 321 3 pepA Probable cytosol aminopeptidase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8SQZ7 1.34e-49 178 36 5 320 1 ECU10_1770i Cytosol aminopeptidase Encephalitozoon cuniculi (strain GB-M1)
A1K9L5 1.68e-49 178 34 9 360 3 pepA Probable cytosol aminopeptidase Azoarcus sp. (strain BH72)
Q21KZ5 2.04e-49 178 35 4 289 3 pepA Probable cytosol aminopeptidase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q73YK2 2.8e-49 178 38 7 322 3 pepA Probable cytosol aminopeptidase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q82AN2 3.35e-49 177 39 6 335 3 pepA Probable cytosol aminopeptidase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8RX72 3.52e-49 179 36 11 340 2 LAP3 Leucine aminopeptidase 3, chloroplastic Arabidopsis thaliana
B0JL23 3.63e-49 177 38 11 316 3 pepA Probable cytosol aminopeptidase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q5HAP2 3.64e-49 177 34 7 320 3 pepA Probable cytosol aminopeptidase Ehrlichia ruminantium (strain Welgevonden)
B7K4A4 4.15e-49 177 35 10 316 3 pepA Probable cytosol aminopeptidase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q5FFZ5 4.34e-49 177 34 7 320 3 pepA Probable cytosol aminopeptidase Ehrlichia ruminantium (strain Gardel)
A5K3U9 4.42e-49 179 35 7 329 1 LAP Leucine aminopeptidase Plasmodium vivax (strain Salvador I)
Q2JKL5 6.6e-49 177 37 6 319 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6MH10 6.76e-49 176 36 6 296 3 pepA Probable cytosol aminopeptidase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q8F0Q1 6.76e-49 176 36 8 341 3 pepA Probable cytosol aminopeptidase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72UC6 6.76e-49 176 36 8 341 3 pepA Probable cytosol aminopeptidase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q21WL3 7.01e-49 176 37 11 322 3 pepA Probable cytosol aminopeptidase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A0LK12 1.48e-48 176 36 7 320 3 pepA Probable cytosol aminopeptidase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
C1A138 1.48e-48 176 38 6 316 3 pepA Probable cytosol aminopeptidase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q72F03 1.96e-48 176 37 9 319 3 pepA Probable cytosol aminopeptidase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B1YKV4 2.02e-48 175 39 10 281 3 pepA Probable cytosol aminopeptidase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q3AZE8 2.24e-48 175 40 7 279 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9902)
Q7V0D4 2.5e-48 175 35 9 330 3 pepA Probable cytosol aminopeptidase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8IL11 3.41e-48 177 34 7 326 1 LAP Leucine aminopeptidase Plasmodium falciparum (isolate 3D7)
Q89AG2 4.05e-48 174 35 5 317 3 pepA Probable cytosol aminopeptidase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P31427 1.05e-47 175 37 12 348 2 LAP Leucine aminopeptidase, chloroplastic Solanum tuberosum
Q3M9J6 1.13e-47 173 38 7 311 3 pepA Probable cytosol aminopeptidase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A8LI79 1.22e-47 173 34 7 318 3 pepA Probable cytosol aminopeptidase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B2J3G8 1.24e-47 173 37 7 315 3 pepA Probable cytosol aminopeptidase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8Z064 1.25e-47 173 38 7 311 3 pepA Probable cytosol aminopeptidase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B7KCB0 1.45e-47 173 37 7 313 3 pepA Probable cytosol aminopeptidase Gloeothece citriformis (strain PCC 7424)
A9IIK3 1.51e-47 173 36 8 356 3 pepA Probable cytosol aminopeptidase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A2SH61 2.35e-47 172 35 5 321 3 pepA Probable cytosol aminopeptidase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B4SJ73 3.02e-47 172 36 4 291 3 pepA Probable cytosol aminopeptidase Stenotrophomonas maltophilia (strain R551-3)
Q9S2Q7 3.05e-47 172 39 5 316 3 pepA Probable cytosol aminopeptidase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8PCR4 5.83e-47 171 35 4 291 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RVI0 5.83e-47 171 35 4 291 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain B100)
Q4UQP6 5.83e-47 171 35 4 291 3 pepA Probable cytosol aminopeptidase Xanthomonas campestris pv. campestris (strain 8004)
B5Z6U1 5.9e-47 171 35 6 329 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain G27)
Q3AHT4 8.35e-47 171 36 8 326 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain CC9605)
Q5V9F0 1.17e-46 171 36 6 316 1 lap Cytosol aminopeptidase Dictyostelium discoideum
Q6AJZ3 1.78e-46 170 40 5 264 3 pepA Probable cytosol aminopeptidase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B2V6F5 2.11e-46 170 34 6 343 3 pepA Probable cytosol aminopeptidase Sulfurihydrogenibium sp. (strain YO3AOP1)
Q5H4N2 2.5e-46 169 35 4 291 1 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SPE7 2.5e-46 169 35 4 291 3 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7G2 2.5e-46 169 35 4 291 3 pepA Probable cytosol aminopeptidase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B0U1L5 2.52e-46 169 35 5 296 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain M12)
Q1CTV6 2.57e-46 169 35 6 329 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain HPAG1)
P73971 3.36e-46 169 36 12 321 3 pepA Probable cytosol aminopeptidase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A1WSK3 3.66e-46 169 37 10 324 3 pepA Probable cytosol aminopeptidase Verminephrobacter eiseniae (strain EF01-2)
Q87F32 4.31e-46 169 35 5 296 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6L3 4.31e-46 169 35 5 296 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain M23)
Q6MC72 4.48e-46 169 33 8 321 3 pepA Probable cytosol aminopeptidase Protochlamydia amoebophila (strain UWE25)
B3QVE8 5.21e-46 169 36 7 294 3 pepA Probable cytosol aminopeptidase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q3BPA1 5.25e-46 169 35 4 291 3 pepA Probable cytosol aminopeptidase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q9PH08 7.2e-46 168 35 5 296 3 pepA Probable cytosol aminopeptidase Xylella fastidiosa (strain 9a5c)
Q8PGR0 7.22e-46 168 35 4 291 3 pepA Probable cytosol aminopeptidase Xanthomonas axonopodis pv. citri (strain 306)
B6JLF2 8.98e-46 168 34 6 329 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain P12)
B2FMS4 1.12e-45 167 35 4 291 3 pepA Probable cytosol aminopeptidase Stenotrophomonas maltophilia (strain K279a)
O25294 1.17e-45 168 34 6 329 1 pepA Cytosol aminopeptidase Helicobacter pylori (strain ATCC 700392 / 26695)
Q1QTE5 1.99e-45 167 38 7 296 3 pepA Probable cytosol aminopeptidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5N569 2e-45 167 35 9 338 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9ZLR1 2.17e-45 167 34 6 329 3 pepA Cytosol aminopeptidase Helicobacter pylori (strain J99 / ATCC 700824)
O06865 2.19e-45 167 35 9 338 3 pepA Probable cytosol aminopeptidase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B2UTQ8 3.37e-45 166 34 6 329 3 pepA Probable cytosol aminopeptidase Helicobacter pylori (strain Shi470)
Q10712 6.56e-45 167 36 12 344 1 LAPA1 Leucine aminopeptidase 1, chloroplastic Solanum lycopersicum
B1WR01 7.56e-45 166 34 6 318 3 pepA Probable cytosol aminopeptidase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A5GV03 1.67e-44 165 41 9 282 3 pepA Probable cytosol aminopeptidase Synechococcus sp. (strain RCC307)
Q5YZ53 1.71e-44 165 36 6 317 3 pepA Probable cytosol aminopeptidase Nocardia farcinica (strain IFM 10152)
Q17W06 3.14e-44 164 34 5 327 3 pepA Probable cytosol aminopeptidase Helicobacter acinonychis (strain Sheeba)
Q67NI4 5.49e-44 163 36 5 314 3 pepA Probable cytosol aminopeptidase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A1VP99 5.71e-44 163 35 9 320 3 pepA Probable cytosol aminopeptidase Polaromonas naphthalenivorans (strain CJ2)
Q9PP04 6.71e-44 162 33 4 321 3 pepA Probable cytosol aminopeptidase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P34629 9.34e-44 162 36 11 324 1 lap-1 Leucine aminopeptidase 1 Caenorhabditis elegans
Q12AW5 1e-43 162 33 5 314 3 pepA Probable cytosol aminopeptidase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B9DIX2 2.53e-43 161 36 9 319 3 pepA Probable cytosol aminopeptidase Staphylococcus carnosus (strain TM300)
P47707 3.37e-43 161 36 6 296 3 pepA Probable cytosol aminopeptidase Metamycoplasma salivarium
Q09735 1.11e-42 160 34 5 314 3 SPAC13A11.05 Putative aminopeptidase C13A11.05 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6NSR8 1.66e-42 160 34 7 320 1 Npepl1 Probable aminopeptidase NPEPL1 Mus musculus
Q8NDH3 1.73e-42 159 34 7 322 1 NPEPL1 Probable aminopeptidase NPEPL1 Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_00445
Feature type CDS
Gene pepB
Product aminopeptidase PepB
Location 102084 - 103379 (strand: 1)
Length 1296 (nucleotides) / 431 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_519
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00883 Cytosol aminopeptidase family, catalytic domain
PF12404 Peptidase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0260 Amino acid transport and metabolism (E) E Leucyl aminopeptidase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07751 PepB aminopeptidase [EC:3.4.11.23] Glutathione metabolism
Metabolic pathways		 -

Protein Sequence

MTQLIMPVTLSYEPASPAWGEKALVSATDKGMTVHLSRKGMLCAVQSAGRKIDGQGIRNVVLSGSNWDLETSWAFWQGFRGPKGARSIEWPELPEADKTELEHRIRIIDWVRDVINTPAEELSPEQLAQRAVDLLCGVSCNSVGYRIIKGEDLREQGYMGIHTVGRGSVRPPVLLALDYNPGKQENAPVFASLVGKGITFDSGGYSLKPTSSMDSMKSDMGGAATLTGALAMAISRGLQKRVKLYLCIADNLVSGNAFKLGDIIRYSNGKSVEIMNTDAEGRLVLADGLIEADKDNAGFIIDAATLTGAAKTAVGNDYHSVMSFDDALYNELMSAADQEKEMFWRLPLAEFHRRQMPSSFADLSNTGAPNTAGASTAAAFLSHFVEDYRKNWLHIDCSATYRKAPSDLWSAGATGYGVRTVAALLLKKAGQ

Flanking regions ( +/- flanking 50bp)

AAATAAAATCTGACTGTTACGGCAGTCTAAAAGTCAAAAGAGAGAACGAAATGACGCAACTCATCATGCCTGTAACCTTATCGTATGAACCTGCTTCTCCGGCGTGGGGAGAGAAAGCCCTGGTCAGCGCGACTGACAAAGGAATGACCGTTCATTTAAGCCGTAAAGGGATGCTGTGCGCCGTGCAGAGCGCGGGCCGCAAAATCGACGGTCAGGGCATCCGCAATGTGGTGCTGAGCGGCAGCAACTGGGATCTGGAAACCAGCTGGGCATTCTGGCAGGGCTTCCGTGGTCCGAAAGGCGCACGCTCGATTGAATGGCCGGAATTACCGGAAGCGGATAAAACCGAACTGGAACACCGTATCCGTATCATCGACTGGGTACGCGACGTTATCAATACCCCGGCGGAAGAGCTGAGCCCGGAACAACTGGCGCAGCGTGCGGTTGATCTGCTGTGCGGTGTTTCCTGCAATTCAGTCGGTTACCGTATCATCAAAGGGGAAGATTTACGCGAGCAGGGCTATATGGGGATCCATACGGTTGGCCGTGGTTCAGTACGTCCGCCGGTACTGCTGGCGCTGGATTACAATCCGGGCAAACAGGAAAATGCGCCGGTGTTCGCCAGCCTGGTCGGTAAAGGGATAACCTTTGACTCCGGCGGCTACAGCCTGAAACCAACTTCCTCCATGGACTCCATGAAATCCGATATGGGCGGCGCAGCCACCCTGACCGGCGCACTGGCAATGGCTATCAGCCGCGGCCTGCAAAAGCGCGTCAAACTGTACCTGTGCATCGCGGATAACCTGGTGAGCGGTAATGCCTTCAAACTGGGTGATATTATCCGTTACAGCAACGGTAAATCCGTTGAAATCATGAATACTGATGCGGAAGGGCGTCTGGTACTGGCGGATGGTCTGATTGAAGCGGACAAAGATAACGCCGGGTTTATCATTGATGCAGCGACCCTGACCGGGGCGGCGAAAACTGCCGTCGGTAACGACTATCACTCTGTGATGAGCTTCGATGATGCGCTGTACAATGAACTGATGTCAGCCGCTGATCAGGAAAAAGAGATGTTCTGGCGCCTGCCGCTGGCAGAATTCCACCGCCGTCAGATGCCGTCCTCCTTTGCGGATCTGAGCAACACCGGGGCACCGAATACTGCGGGGGCAAGTACCGCAGCGGCATTCCTGTCTCACTTTGTGGAAGATTACCGCAAAAACTGGCTGCACATTGACTGCTCAGCCACTTACCGCAAAGCGCCGTCAGACTTATGGTCTGCGGGTGCAACCGGGTACGGTGTGCGCACTGTGGCGGCACTGCTGCTGAAAAAAGCCGGACAGTAACCGGGCATTGCCCTGCTGATTCTGCTGTAAAACGGTCACATAAACATGTG